Tobacco outward-rectifying potassium ion channel gene NtSKOR1 as well as cloning method and application thereof

A technology of potassium ion channel and cloning method, which is applied in the field of tobacco outward rectification potassium ion channel gene NtSKOR1 and its cloning field, and can solve the problem of high rate

Active Publication Date: 2019-03-15
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Active absorption costs energy, but the rate of active absorption is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco outward-rectifying potassium ion channel gene NtSKOR1 as well as cloning method and application thereof
  • Tobacco outward-rectifying potassium ion channel gene NtSKOR1 as well as cloning method and application thereof
  • Tobacco outward-rectifying potassium ion channel gene NtSKOR1 as well as cloning method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Tobacco potassium outward rectifier gene NtSKOR1 Clone of

[0078] A. According to Arabidopsis AtSKOR The protein sequence of the gene (NP_186934.1) searched NCBI database to get the homologous gene in tobacco NtSKOR1 Sequence, use this sequence to design gene cloning primers:

[0079] Forward primer: NtSKOR1F: 5’-ATGACGAGAGTAGCAGAGGA-3’

[0080] Reverse primer: NtSKOR1R: 5’- TCAAGTTGATTGATCATTGATC-3’

[0081] B. Extract RNA from tobacco root tissue and reverse transcription to obtain the first strand cDNA;

[0082] C. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers NtSKOR1F / NtSKOR1R, and the PCR products were separated by agarose gel electrophoresis and then recovered and purified ( figure 1 );

[0083] D. Connect the purified product to the carrier. The connection system and process are as follows: 4μL of purified product, 1μL of salt solution, 1μL of PCR®-BluntⅡ-TOPO (Invitrogen), mix well, 25℃, water b...

Embodiment 2

[0087] tobacco NtSKOR1 Gene tissue-specific expression analysis

[0088] A. To plant and cultivate tobacco Yunyan 87, extract RNA from roots, stems and leaves during the vigorous period, and reverse transcription to obtain the first strand cDNA.

[0089] B. According to NtSKOR1 Gene sequence design qRT-PCR primer

[0090] QF: GTCAAGTTGTAACTCGAGTCCAC,

[0091] QR: GGAAATATCTCCGAATGAGCTG.

[0092] Tobacco Actin gene was used as internal control, Actin-F: CTGAGGTCCTTTTCCAACCA and Actin-RTACCCGGGAACATGGTAGAG. Fluorescence quantitative PCR was performed using cDNA of roots, stems and leaves as templates. The reaction was performed on RocheLightCycler 480 using LightCycler 480 SYBR Green I master. The 20 µL system contained 10 µL LightCycler 480 SYBR Green I master (2×), and the forward and reverse primers were 1 µL each. (10 µmol / L), cDNA 1 µL (reverse transcription product diluted 4 times), 7 µL sterilized distilled water. The reaction procedure is as follows: 95°C pre-denaturation for 5...

Embodiment 3

[0094] tobacco NtSKOR1 Analysis of Conserved Domains of Gene Coded Proteins

[0095] A multiple sequence alignment of NtSKOR1 protein and Arabidopsis AtSKOR protein ( image 3 ). NtSKOR1 has the conserved domains of SKOR protein, such as transmembrane region S1-S6, pore forming region P, anchor protein region ANK and other conserved domains, and NtSKOR1 has high homology with AtSKOR in these domains.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco outward-rectifying potassium ion channel gene NtSKOR1 as well as a cloning method and application thereof. The nucleotide sequence of the tobacco outward-rectifying potassium ion channel gene NtSKOR1 is as shown in SEQ ID NO. 1, and the amino acid sequence of encoded protein is as shown in SEQ ID NO. 2. The cloning method comprises the steps: synthesis of cDNA oftobacco leaves, specifically, extracting total RNA of the tobacco leaves, and performing reverse transcription to obtain a first strand of the cDNA; and PCR amplification of the NtSKOR1 gene, specifically, using the cDNA of the tobacco leaves as a template, designing a primer according to the NtSKOR1 gene sequence, performing PCR amplification, recycling and purifying PCR amplification products, and performing sequencing. The application is characterized in that the tobacco outward-rectifying potassium ion channel gene NtSKOR1 is applied to transgenic tobacco plants with the tobacco potassiumcontent regulated. The cloned NtSKOR1 gene is subjected to functional identification through a CRISPR / CAS9 technology. The cloning and identification of the tobacco NtSKOR1 gene provides a novel genetarget for regulating the potassium content of tobacco.

Description

Technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a tobacco outward rectifier potassium ion channel gene NtSKOR1 And its cloning method and application. Background technique [0002] Potassium is one of the mineral nutrients necessary for plant growth, and it is the most abundant monovalent cation in plants. Plants absorb potassium mainly through the roots, and the absorption form is K + . There are two ways for plants to absorb potassium: active absorption and passive absorption. Active absorption requires energy, but the rate of active absorption is very high. K in soil solution + At higher concentrations, K + The absorption is mainly passive absorption. Potassium in plants is K + The form exists. The K+ absorbed by roots is easily transported to the ground, and it is also easily transferred from one part to other parts in the plant body, and can be reused in the plant body. In the case of insufficient p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/10C12N15/82A01H5/00A01H6/82
CPCC12N15/8243C07K14/415
Inventor高玉龙王丙武宋中邦李梅云李文正焦芳婵吴兴富隋学艺赵璐李永平邹聪明
OwnerYUNNAN ACAD OF TOBACCO AGRI SCI