Tobacco outward-rectifying potassium ion channel gene NtSKOR1 as well as cloning method and application thereof
A technology of potassium ion channel and cloning method, which is applied in the field of tobacco outward rectification potassium ion channel gene NtSKOR1 and its cloning field, and can solve the problem of high rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] Tobacco potassium outward rectifier gene NtSKOR1 Clone of
[0078] A. According to Arabidopsis AtSKOR The protein sequence of the gene (NP_186934.1) searched NCBI database to get the homologous gene in tobacco NtSKOR1 Sequence, use this sequence to design gene cloning primers:
[0079] Forward primer: NtSKOR1F: 5’-ATGACGAGAGTAGCAGAGGA-3’
[0080] Reverse primer: NtSKOR1R: 5’- TCAAGTTGATTGATCATTGATC-3’
[0081] B. Extract RNA from tobacco root tissue and reverse transcription to obtain the first strand cDNA;
[0082] C. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers NtSKOR1F / NtSKOR1R, and the PCR products were separated by agarose gel electrophoresis and then recovered and purified ( figure 1 );
[0083] D. Connect the purified product to the carrier. The connection system and process are as follows: 4μL of purified product, 1μL of salt solution, 1μL of PCR®-BluntⅡ-TOPO (Invitrogen), mix well, 25℃, water b...
Embodiment 2
[0087] tobacco NtSKOR1 Gene tissue-specific expression analysis
[0088] A. To plant and cultivate tobacco Yunyan 87, extract RNA from roots, stems and leaves during the vigorous period, and reverse transcription to obtain the first strand cDNA.
[0089] B. According to NtSKOR1 Gene sequence design qRT-PCR primer
[0090] QF: GTCAAGTTGTAACTCGAGTCCAC,
[0091] QR: GGAAATATCTCCGAATGAGCTG.
[0092] Tobacco Actin gene was used as internal control, Actin-F: CTGAGGTCCTTTTCCAACCA and Actin-RTACCCGGGAACATGGTAGAG. Fluorescence quantitative PCR was performed using cDNA of roots, stems and leaves as templates. The reaction was performed on RocheLightCycler 480 using LightCycler 480 SYBR Green I master. The 20 µL system contained 10 µL LightCycler 480 SYBR Green I master (2×), and the forward and reverse primers were 1 µL each. (10 µmol / L), cDNA 1 µL (reverse transcription product diluted 4 times), 7 µL sterilized distilled water. The reaction procedure is as follows: 95°C pre-denaturation for 5...
Embodiment 3
[0094] tobacco NtSKOR1 Analysis of Conserved Domains of Gene Coded Proteins
[0095] A multiple sequence alignment of NtSKOR1 protein and Arabidopsis AtSKOR protein ( image 3 ). NtSKOR1 has the conserved domains of SKOR protein, such as transmembrane region S1-S6, pore forming region P, anchor protein region ANK and other conserved domains, and NtSKOR1 has high homology with AtSKOR in these domains.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com