Method for rapidly constructing target pU6-sgRNA plasmids required for caenorhabditis elegans gene editing

A pu6-sgRNA, Caenorhabditis elegans technology, applied in DNA/RNA fragments, recombinant DNA technology, introduction of foreign genetic material using vectors, etc. The effect of low cost, reduced working time and wide adaptability

Inactive Publication Date: 2019-03-15
福建上源生物科学技术有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Therefore, it is necessary to establish a method for quickly constructing the target pU6-sgRNA plasmid required for gene editing in Caenorhabditis elegans, in order to solve the traditional method of using a large number of primers, long primers, cumbersome process, long time and high error-prone rate. question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly constructing target pU6-sgRNA plasmids required for caenorhabditis elegans gene editing
  • Method for rapidly constructing target pU6-sgRNA plasmids required for caenorhabditis elegans gene editing
  • Method for rapidly constructing target pU6-sgRNA plasmids required for caenorhabditis elegans gene editing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Construction of pU6-rho-1sgRNA plasmid by traditional two-step PCR method

[0058] see figure 1 and figure 2 , This embodiment provides a method for constructing pU6-rho-1 sgRNA plasmid in the traditional two-step PCR method described in the background art. The technical principle is that the pU6-unc-119 sgRNA plasmid (#46169) is used as the original vector, and the target sequence of the sgRNA plasmid is shown in SEQ ID NO.2. Using this plasmid as the original vector, it is necessary to replace the 20bp sgRNA target DNA sequence of unc-119sgRNAtarget 902..921 gene loci with sgRNA target DNA sequences of different gene loci to obtain sgRNA plasmids containing different target DNA sequences.

[0059] see figure 2 , using a two-step PCR method to construct pU6-rho-1sgRNA, the specific steps are as follows:

[0060] 1) Using the pU6-unc-119sgRNA plasmid as a template, digest with two restriction enzymes Eco RI and Hind III to release a 846bp fragment, including the U...

Embodiment 2

[0071] This embodiment provides an improved method for constructing pU6-rho-1sgRNA plasmid

[0072] see Figure 3-Figure 5 , the inventors first transformed the original vector of pU6-unc-119sgRNA. Insert two opposite BseRI restriction sites AGCTGAGT between the U6 promoter and the sgRNA backbone sequence CTCCTC GAT GAGGAG CAGATCAG (the underlined part) and the spacer sequence are used to construct the pU6-2XBseRI-sgRNA plasmid. The subsequent plasmid construction is based on the pU6-2XBseRI-sgRNA plasmid. The specific steps for subsequent construction of the plasmid are as follows:

[0073] 1) Digestion of pU6-2X BseRI-sgRNA plasmid with BseRI: Mix 4 μL of pU6-2XBseRI-sgRNA plasmid, 10 μL of 10xCutsmart digestion buffer required for BseRI digestion, 2 μL of BseRI enzyme, and 84 μL of double distilled water in a PCR tube. Enzyme digestion at ℃ for 1h, heat shock treatment at 80℃ to terminate the digestion reaction, run 1% gel electrophoresis on the digested product, recov...

Embodiment 3

[0106] This example provides a method for constructing pU6-F33A8.4-sgRNA1 plasmid

[0107] If you need to construct other sgRNA plasmids, the relevant primers you need are:

[0108] F: 5'-N20GT-3', wherein N20 represents the first 20bp sgRNA target site sequence of PAM (NGG);

[0109] R: 5'-n20AA-3', wherein n20 represents the reverse complementary sequence of the first 20 bp sgRNA target site sequence of PAM (NGG);

[0110] The difference from Example 2 is that the target site sequence and the primer sequence to be synthesized are:

[0111] The F33A8.4-sg1 target site sequence is GAAGGACCATGAGAGCACTG (as shown in SEQ ID NO.12);

[0112] Primers to be synthesized:

[0113] F33A8.4-sg1-F: GAAGGACCATGAGAGCACTGGT (as shown in SEQ ID NO.13);

[0114] F33A8.4-sg1-R: CAGTGCTCTCATGGTCCTTCAA (as shown in SEQ ID NO.14);

[0115] The gel electrophoresis images of screened positive bacterial liquid clones are as follows: Figure 8 As shown, the positive rate of pU6-F33A8.4-sgRNA1 p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of elegans gene editing, and more specifically discloses a method for rapidly constructing target pU6-sgRNA plasmids required for caenorhabditis elegans gene editing. pU6-2X BseRI-sgRNA plasmids are constructed by modifying an original carrier for caenorhabditis elegans pU6-unc-119sgRNA, the pU6-2X BseRI-sgRNA plasmids are digested by using BseRI enzymeto obtain a carrier with cohesive ends, sgRNA target DNA small fragments with cohesive ends are formed by positive and negative primers containing sgRNA target sequences and cohesive ends through annealing, under the effect of T4DNA ligase, the carrier is connected with the sgRNA target DNA small fragments with the mated cohesive ends, DH5 alpha competent cells are converted, positive monoclonesare screened from escherichia coli after conversion, and whether an sgRNA target sequence is correct is verified through sequencing. By using the technical scheme, the construction period is less thanone day, the operation before T4DNA ligase consumes less than half an hour and is reduced by at least four hours compared with pure manpower consumed time in a conventional method, and the construction period is reduced by two days. The sgRNA plasmid is constructed as long as only two primers containing 44 basic groups need to be synthesized, so that the construction cost is greatly reduced.

Description

technical field [0001] The invention belongs to the technical field of nematode gene editing, and more specifically relates to a method for rapidly constructing a pU6-sgRNA plasmid required for gene editing of Caenorhabditis elegans. Background technique [0002] Considering the economic cost and workload, most nematode laboratories nowadays seldom conduct gene editing by injecting Cas9 protein and transcribed sgRNA (single guide RNA for short), but mostly by directly injecting Cas9 and sgRNA plasmids method to modify the genome. [0003] The key to the CRISPR / Cas9 gene editing system is to find a suitable sgRNA target site. On the one hand, the sgRNA target site must have no off-target effects; on the other hand, the sgRNA target site must be recognized by the sgRNA-Cas9 binary complex. Cas9 binds stably and is cleaved by Cas9 proteolytically to form a double-stranded DNA nick. sgRNA plays an important role in these two key steps. [0004] The guide RNA discovered earlie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/113C12N15/66
CPCC12N5/04
Inventor赵培康雅虹谢喜珍
Owner福建上源生物科学技术有限公司