U1-snRNA for repairing TPP1 gene Pre-mRNA aberrant splicing and application of U1-snRNA

A gene splicing, u1-snrna technology, applied in DNA/RNA fragments, gene therapy, genetic engineering and other directions, can solve the problems of difficult, undiscovered, and high repair efficiency of abnormal splicing, so as to make up for the lack of treatment methods and improve splicing. Repair efficiency and specificity

Active Publication Date: 2019-03-19
THE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the repair of abnormal splicing caused by the mutation of the 5'ss+1 site has always been an international problem, and no reports of higher repair efficiency have been found.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • U1-snRNA for repairing TPP1 gene Pre-mRNA aberrant splicing and application of U1-snRNA
  • U1-snRNA for repairing TPP1 gene Pre-mRNA aberrant splicing and application of U1-snRNA
  • U1-snRNA for repairing TPP1 gene Pre-mRNA aberrant splicing and application of U1-snRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] An embodiment of the U1-snRNA single-stranded molecule of the present invention targets the position downstream of the splice donor site of exon 12 of the TPP1 gene, and the DNA base sequence corresponding to the 165bp single-stranded molecule is such as ex12Mut, Cln2- 1. As shown in Cln2-9 or Cln2-16, wherein, the underline shows the splice donor site with the TPP1 gene Exon12 or the intron sequence downstream of the splice donor site (as shown in SEQ ID NO.19, which includes the Exon12 splice donor site ATA is a sequence complementary to the bases on the wild-type TPP1 gene, so as to facilitate the transcription initiation of U1-snRNA. The transcribed U1-snRNA single-stranded molecules, for example, U1-snRNA Cln2-16 compared with SEQ ID NO.1, just replace T with U; correspondingly, U1-snRNA ex12 Mut, Cln2-9, Cln2- Compared with the RNA sequence of 16 and SEQ ID NO.2-4, just replace T with U.

[0039] ex12Mut:ATA ACTTATATC GCAGGGGAGATACCATGATCACGAAGGTGGTTTTTCCCAGGGC...

Embodiment 2

[0047] Example 2 The method for constructing targeted U1-snRNA expression vector

[0048] The U1-snRNA fragment was amplified using human genomic DNA as a template, and 641 bp of human U1-snRNA was amplified by PCR with NEB Q5 high-fidelity enzyme, in which 164 bp was the expression sequence of U1-snRNA marked underlined. U1-snRNA fragment amplification primer sequence is:

[0049] F: 5'-TTTGGATCCGACCAGCTTCTTTGGGAGAGAA-3' (SEQ ID NO.6);

[0050] R: 5'-TTTAAGCTTTTCCAAAAAACACCAACCAAGACACAAACCA-3' (SEQ ID NO. 7).

[0051] The human U1-snRNA gene sequence is as shown in SEQ ID NO.5, wherein the first underline is the U1 promoter sequence, the second underline is the U1-snRNA expression sequence, and the third underline is the U1 transcription terminator sequence:

[0052] CTAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCTCTTGGC GACTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACT GTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGC...

Embodiment 3

[0054] Example 3 Method for preparing targeted U1-snRNA by in vitro transcription

[0055] U1-snRNA in vitro transcription kit containing T7 RNA polymerase from Beijing Biolab Technology Co., Ltd. was used for in vitro transcription preparation.

[0056] a. Preparation of DNA template.

[0057] The U1-snRNA fragment of Example 1 was inserted between the BamHI and HindIII restriction sites of the pcDNA3.1(-) vector, used as a template for in vitro transcription, and the vector was linearized with BglII endonuclease. There is a T7 promoter upstream of the vector pcDNA3.1(-)-U1-snRNA fragment, which can be used for in vitro transcription.

[0058] b. In vitro transcription reaction.

[0059] In an RNase-free plastic centrifuge tube, add the following components in sequence at room temperature: 2 μg of DNA template (i.e., the vector pcDNA3.1(-)-U1-snRNA fragment obtained in step a), 25 μl of transcription premix (2 ×T7), 2μl T7 RNA polymerase, add RNase-free water to 50μl. Inc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a U1-snRNA for repairing TPP1 gene splicing defects and a vector containing a base sequence for expressing the U1-snRNA. The base sequence for expressing the U1-snRNA sequentially comprises a U1-snRNA initial basic group, a sequence complemented with a TPP1 gene Exon12 donor splicing site or a downstream intron sequence target and a U1-snRNA downstream sequence, and the U1-snRNA downstream sequence is as shown in SEQ ID NO.20. The U1-snRNA is from a nucleic acid molecule prepared according to a TPP1 gene donor splicing site or donor splicing site downstream intron sequence. By the aid of a U1-snRNA technique, U1-snRNA of a target gene serves as a target medicine, and repairing is implemented in the splicing process of Pre-mRNA, so that aberrant mRNA expression caused by splicing site mutation is effectively restrained. The U1-snRNA has the advantages of high specificity, high efficiency and small side effect, can make up for the deficiency of current treatment means of diseases caused by aberrant splicing and possibly serves as a new method for treating specific types of diseases in the near future.

Description

technical field [0001] The invention relates to the technical field of gene repair, in particular to U1-snRNA for repairing abnormal splicing of TPP1 gene Pre-mRNA and its application. Background technique [0002] Previous studies have found that Pre-mRNA (mRNA precursor) splicing can associate mutations with diseases through extensive analysis of genome-wide data and cell line data. A large number of mutations have been found to regulate genes in neurological diseases such as Duchenne muscular dystrophy (DMD) and multiple sclerosis by affecting pre-mRNA splicing. Splice site mutations account for about 10% of the total number of disease-related mutations, and the role of pre-mRNA splicing in disease occurrence needs attention. [0003] Neuronal ceroid lipofuscinosis (neuronal ceroid lipofuscinosis, NCLs) is a group of different types of lysosomal storage disorders, is an autosomal recessive neurodegenerative disease, about every 100,000 newborns There are 2-4 cases. Lat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/70A61K31/7105A61K48/00A61P25/28
CPCA61P25/28A61K31/7105C12N15/113C12N15/70C12N2310/141C12N2310/531
Inventor汤斌易咏红
OwnerTHE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV