Improved method for selecting polypeptide producing cells

A technology of nucleic acid and nucleic acid fragments, which is applied in the field of recombinant polypeptide production and can solve the problems of time-consuming and expensive

Active Publication Date: 2019-05-21
F HOFFMANN LA ROCHE & CO AG
View PDF17 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is time consuming and therefore expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved method for selecting polypeptide producing cells
  • Improved method for selecting polypeptide producing cells
  • Improved method for selecting polypeptide producing cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0439] Cloning of genomic fragments and construction of eukaryotic sIgG / mIgG expression plasmid

[0440] a) Construction of sIgG expression plasmid pIgG

[0441] In order to express immunoglobulins with binding specificity to protein antigens, plasmids were constructed. It encodes immunoglobulin in the form of secreted sIgG and contains the following elements:

[0442] 1. The transcription unit of human γ1 heavy chain, which contains:

[0443] -Immediate early enhancer and promoter from human cytomegalovirus (hCMV);

[0444] -A synthetic 5'untranslated region containing the Kozak consensus sequence (Kozak, M., Nucleic Acids Res. 15 (1987) 8125-48);

[0445] -Mouse immunoglobulin heavy chain signal sequence, including signal sequence introns;

[0446] -The variable heavy chain cDNA of an antibody with binding specificity to the protein antigen;

[0447] -Including mouse Igμ enhancer (J H 3-J H 4 Transition region) mouse / human heavy chain heterozygous intron 2 which is connected to the huma...

Embodiment 2

[0636] Transfection and library selection

[0637] The CHO-K1 cells (ATCC No. CCL-61; Puck, TT et al., J. Exp. Med. 108 (1958), 945-956) that have been pre-adapted to grow in suspension culture without serum in the suspension culture flask 37°C, 5% CO 2 It was cultured in ProCHO4-CDM medium (Cambrex) supplemented with 8mM L-alanyl-L-glutamine (Invitrogen) and 1x HT supplement (Invitrogen) with 95% humidity. Press the cells 2x10 every 3-4 days 5 Cells / ml are divided into fresh medium. For transfection, press 20μg plasmid DNA / 7.5x10 in a total volume of 200μl PBS at room temperature. 6 Cell electroporation cells. A single 160V pulse, 15ms using a square wave process, with a Gene Pulser XCell electroporator (BioRad) in a 2mm gap electroporation cup for electroporation. The linearized plasmids pmIgGΔ-mut-bp, pmIgGΔ-mut-p(Y), pmIgGΔ-mut-bp-p(Y), pmIgGΔ-mut-ESE, pmIgGΔ-SV40p(A), pmIgGΔ-BGH-p( A) or pmIgGΔ-B transfected cells. Then, one day after transfection, each transfected cell ...

Embodiment 3

[0639] Northern blot analysis

[0640] In order to determine the ratio between the two heavy chain isoforms arising from the selective RNA processing of the primary transcript, the RNA of the stably transfected clone was analyzed by Northern blot. Therefore, the RNeasy kit (QIAGEN) was used to isolate total RNA from the 7 stably transfected cell banks described in Example 2. In addition, RNA of untransfected CHO-K1 cells was prepared under the same conditions. In each case, 10 μg of total RNA was then fractionated by denaturing agarose gel electrophoresis and transferred to a nylon membrane using the NorthernMax System (Ambion). In order to hybridize the blot membrane, use DECAprime II kit (Ambion) by random priming method with [α- 32 P] labeled two different DNA probes. Such as figure 2 As shown in B, probe 1 and exons CH1 and C H The heavy chain mRNA between 3 is complementary and therefore hybridizes with the two isotypes. In contrast, Probe 2 only binds to the 3'UTR of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Herein is reported a nucleic acid comprising in 5' to 3' direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5' splice donor site of an 5 immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the3' splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a thirdnucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane 10 domain, wherein the second nucleic acid fragment has at its 3' terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Description

[0001] The invention belongs to the field of polypeptide production. This paper reports a nucleic acid comprising an alternatively spliced ​​nucleic acid, a cell comprising this nucleic acid, a method for isolating a cell expressing a recombinant (heterologous) polypeptide from the nucleic acid reported herein, and a method for producing a recombinant (heterologous) polypeptide . Background technique [0002] The expression system used to produce recombinant polypeptides is well known in the prior art, and is described by, for example, Marino, MH, Biopharm. 2 (1989) 18-33; Goeddel, DV, etc., Methods Enzymol. 185 (1990) 3-7; Wurm, F. and Bernard, A., Curr. Opin. Biotechnol. 10 (1999) 156-160. For the production of polypeptides and proteins for pharmaceutical applications, it is preferable to use mammalian host cells, such as CHO cells, BHK cells, NSO cells, Sp2 / 0 cells, COS cells, HEK cells, Cells etc. Preferably, the nucleic acid encoding the polypeptide is included in the nuc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/00C12N15/85
CPCC07K16/00C12N15/85C07K2317/14C07K2317/52C07K2319/01C12N2830/20C12N2830/42C07K2317/526C07K2317/528C07K2319/03
InventorE·科佩茨基O·普罗特奈尔
OwnerF HOFFMANN LA ROCHE & CO AG