A primer and method for enriching a target region
A target area and enrichment technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of complex operation process, high cost, long cycle, etc., to ensure accuracy, The effect of reducing operation steps and reducing material loss
Active Publication Date: 2022-04-05
AMOY DIAGNOSTICS CO LTD +1
View PDF4 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Hybrid capture is characterized by good scalability and the ability to capture larger target areas, but the operation process is complicated, the cycle is long, the cost is high, and it needs to rely on more special instruments and equipment
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0064] 1. Interruption of DNA and connection and purification of tag sequence 1
[0065] The genomic DNA of the cell line HCT15 was interrupted by Tn5 transposase, and the tag sequence 1 sequenced by the sequencing platform was added to both ends of the interrupted sequence. In this embodiment, the platform used is the Illumina platform, and the tag sequence 1 is a part of the adapter connected with the ME sequence.
[0066] This part is divided into two steps. First, construct the transposome and prepare the reaction system shown in Table 1 (the recognition sequence is ME as an example).
[0067] Table 1
[0068] name Volume (μL) Connector with ME sequence (10pmol / μL) 1.0～1.5 10×TPS buffer 2 Rubust Tn5 transposase 1 TE buffer (100mM Tris-HCl, 0.1mM EDTA, pH8.0) to 20
[0069] Among them, the ME sequence is 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
[0070] TCTACACATATTCTCTGTC-p-5'(ME19)
[0071] The above reactants were mixed and reacted...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses a primer and a method for enriching a target region. The method includes the following steps. Step 1: DNA fragmentation and tag sequence 1 connection and product purification; Step 2: enrichment of the target region set; the enrichment of the target region is accomplished by multiple specific PCR amplification, that is, under the action of the high-fidelity DNA polymerase, the primers of the present invention are used for linear amplification; the high-fidelity DNA polymerase used for the enrichment of the target region has nick translation, which can Under appropriate reaction conditions, fill in the nick produced by the transposase breaking the double-stranded DNA fragment; step 3: use adapter primers for PCR amplification; the two adapter primers used for amplification have the same structure and include 3 parts: and sequencing The linker sequence for oligonucleotide binding on the chip, the Index sequence used to distinguish samples from different sources, and the above-mentioned tag sequence 1 or tag sequence 2.
Description
technical field [0001] The present invention relates to a primer and a method for enriching a target region. Background technique [0002] Genes are fragments of DNA or RNA molecules that carry specific genetic information. Gene mutation is a change in the composition or sequence of base pairs in the molecular structure of a gene, including point mutations, frameshift mutations, deletion mutations, and insertion mutations. Genetic testing is a technique for detecting gene sequence information in human blood, body fluids or tissue cells, which can be used for disease diagnosis or disease risk prediction. Numerous studies have found that tumorigenesis is essentially the result of the joint action of environmental factors and genetic factors, and its pathological process involves mutations of various genes. Tumor-related genes are usually easily abnormally activated or abnormally inactivated or lost, causing cell damage. Malignant transformation, thus forming tumors, endanger...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6806C12N15/11
Inventor 康雅君葛会娟黄可君施佳卉张林华金保雷阮力郑立谋
Owner AMOY DIAGNOSTICS CO LTD