Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for breeding high-nodule nitrogen fixing transgenic plant

A technology of transgenic plants, nodulation, applied in the field of genetic engineering

Active Publication Date: 2019-06-07
HUAZHONG AGRI UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the mechanism of GH3-mediated soybean symbiotic nitrogen-fixing bacteria-plant interaction process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for breeding high-nodule nitrogen fixing transgenic plant
  • Method for breeding high-nodule nitrogen fixing transgenic plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1, Extraction of total RNA in Wilimas82 soybean tissue.

[0032] The mortar has been treated at 180 ℃ for 8 hours or burned to eliminate RNase contamination; reagents such as chloroform, isopropanol, and ethanol should be freshly opened and uncontaminated; other equipment such as pipette tips, centrifuge tubes and reagents such as ultrapure water , NaAc, were treated with 1‰ DEPC water overnight, and then sterilized by high temperature and humidity at 121 ℃ for 30 minutes. The pipette tip and centrifuge tube were dried at 65 ℃ for later use; the total RNA of soybean was extracted by Trizol method.

[0033] (1) Take 50 mg of the material (leaf) and grind it with liquid nitrogen, add 1 mL of TRI pure reagent, after fully homogenizing, inhale the homogenate into a 1.5 mL centrifuge tube, and place it at room temperature for 5 min;

[0034] (2) Add 200 μL of chloroform, vortex to mix, let stand for 5 minutes, 4 ℃, 12000 r / min, centrifuge for 10 minutes;

[0035] (3...

Embodiment 2

[0037] Embodiment 2, reverse transcription PCR.

[0038] (1) Sequentially add 5 μL RNA and 3 μL oligo dt to a 200 μL PCR tube treated with DEPC; 4 μL dNTPs, incubate at 65 °C for 5 min and then quickly cool on ice;

[0039] (3) Add the following solutions in the following order: 5X M-MLV buffer (manufactured by Invitrogen) 4 μL, RNase inhibitor 1 μL, M-MLV 1 μL, 0.1M DTT 2 μL;

[0040] (4) Mix the above reaction solution and react at 37 °C for 30 min;

[0041] (5) After the reaction, treat at 70 °C for 10 min to inactivate the reverse transcriptase activity; the first strand of cDNA synthesized by the reaction can be used as a template for PCR reaction.

Embodiment 3

[0042] Example 3. Construction of recombinant expression vectors.

[0043] (1) GmGH3.1 Cloning of gene fragments.

[0044] according to GmGH3.1 A primer pair was designed for the coding sequence (SEQ ID NO; 1) for the construction of an overexpression vector. According to the multiple cloning site on the vector pTF101, the ends of the primers were respectively introduced into Xba I and Bam H I digestion recognition site; carry out PCR with the cDNA of soybean sequencing variety W82 as template, amplify GmGH3.1 A 1782 bp gene fragment (SEQ ID NO: 1); the primer sequence is:

[0045] Forward primer: CGCGGATCCATGGCCGTTGATTCTGAG (SEQ ID NO: 2);

[0046] Reverse primer: GCTCTAGATCAACGACGACGTTCTGG (SEQ ID NO: 3);

[0047]The amplification program is: 95°C for 5 minutes; 95°C for 30 seconds, 56°C for 30 seconds, 68°C for 2 minutes, 30 cycles; 72°C for 70 seconds;

[0048] The PCR amplification product was subjected to 1% agarose gel electrophoresis, and the band of about ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for breeding a high-nodule nitrogen fixing transgenic plant. The nucleotide sequence as shown in SEQID NO:1 in a sequence table is subjected to overexpression in a plant body, and a transgenic plant having high nodule nitrogen fixing capacity compared with a normal plant is obtained. Experiment verifies that the transgenic plant is obtained through transforming anacceptor namely a glycine max plant through an overexpression vector constructed by the method, the nodule nitrogen fixing capacity of the glycine max can be notably improved, and the method has important actual significance in increasing the yield of the glycine max. The technical scheme of the method has actual value in the two respects of basic scientific research and farming and forestry application.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a gene capable of improving plant nodulation and nitrogen fixation ability and its application. Background technique [0002] Soybean originated in China and is an important economic grain and oil crop in my country. As a leguminous plant, soybean has special root nodules of lateral organs. Soybeans can symbiotically fix nitrogen through mutually beneficial cooperation with rhizobia, converting nitrogen in the air into nitrogen nutrients that can be absorbed and utilized by plants, which not only reduces the amount of nitrogen fertilizer application but also ensures the yield and quality of soybeans. Therefore, symbiotic nitrogen fixation is an important trait to maintain high and stable soybean yield. [0003] In the prior art, there have been many studies on improving soybean nodulation and nitrogen fixation ability through transgenic technology. However, there i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/11C12N15/29A01H5/00A01H6/54
Inventor 王幼宁李沅芹曹金山李国纪李霞
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com