A probe for identifying centromere chromosome in the middle part of Ezo scallop and its preparation method

A scallop and chromosome technology, applied in the field of shellfish chromosome research, to achieve the effect of easy distinction and obvious signal

Active Publication Date: 2022-02-25
OCEAN UNIV OF CHINA
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, Ezo scallop lacks corresponding markers as probes to efficiently and quickly identify chromosomes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A probe for identifying centromere chromosome in the middle part of Ezo scallop and its preparation method
  • A probe for identifying centromere chromosome in the middle part of Ezo scallop and its preparation method
  • A probe for identifying centromere chromosome in the middle part of Ezo scallop and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: the preparation of probe

[0030] 1) Fosmid monoclonal screening: According to the integration of the SNP linkage map and the chromosome map of Scallop scallops, the three SNP markers screened by the three linkage groups LG6, LG9 and LG19 correspond to the middle centromere chromosome of Scallop scallops.

[0031] SNP marker M8173 identifying the first pair of middle centromere chromosomes, the nucleotide sequence of which is CAGACAGGGAGCTATAGTTTGTACTTA (SEQ ID NO: 1);

[0032] The SNP marker M7337 identifying the second pair of middle centromere chromosomes has a nucleotide sequence of TTTCAATTTACTTAAACTCCCTGTTAT (SEQ ID NO: 2);

[0033] SNP marker M687 identifying the third pair of middle centromere chromosomes, the nucleotide sequence of which is TTATTCTATACGAGGACTCCAGCTTTT (SEQ ID NO: 3);

[0034] The above-mentioned SNP markers were used to prepare probes for mapping the three pairs of mesocentromere chromosomes of Scallop scallops.

[0035] First, ...

Embodiment 2

[0041] Example 2: Mapping Chromosomes Using Probes

[0042]1) Chromosome preparation: use a 500-mesh sieve to collect trochophore larvae, use 0.01% colchicine for 2.5 hours to fix the larvae, then use 0.075M KCL to perform hypotonic treatment on the larval material for 30 minutes, and then The material is placed in freshly prepared Carnot's reagent, and the Carnot's reagent is replaced three times. Here, the material can be stored at -20°C for a long time, and then dissociated with freshly prepared 50% acetic acid for 5-10 minutes. The hot drop method was used to prepare the slides, the chromosome material was fixed on the glass slide, and placed in an oven at 60°C for 2 to 3 hours to make the chromosome material closely adhere to the glass slide and prevent the chromosome material from falling off during the hybridization process. References for chromosome preparation (Huang et al. al. 2007. Mapping of ribosomal DNA and (TTAGGG)n telomeric sequence by FISH in the bivalve Pati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for identifying the centromere chromosome in the middle part of the scallop. By combining the genome sequence information of the scallop, the SNP linkage map information and the fosmid monoclonal decoding information, three chromosomes distributed on the SNP linkage map of the scallop are selected. Screen the fosmid library with each marker, use the clones containing SNP sites to prepare fluorescently labeled probes, and then use these probes for fluorescence in situ hybridization and co-hybridization, according to the three specific clones containing SNP markers The distribution of the fluorescent signal on the chromosomes of Scallop scallops realized the specific recognition of three pairs of mesocentromere chromosomes in scallops. The three markers provided by the present invention realize the identification of three pairs of middle centromere chromosomes, and are of great significance to the discrimination and identification of the chromosomes of the scalloped scallop, the construction of the cytogenetics map, and the evolution analysis of chromosomes from different species .

Description

technical field [0001] The invention belongs to the technical field of shellfish chromosome research, and in particular relates to a probe for identifying centromere chromosomes in the middle of the scallop and a preparation method thereof. Background technique [0002] Scallop (Jay, 1857) is a cold-water bivalve mollusk and an important aquaculture species with great scientific and economic value. There are 19 pairs of chromosomes in scallops, including four chromosome types: mesocentromere, submetacentromere, subtelocentromere and telocentromere. The results of karyotype analysis showed that the size of the homochromosomes of the scallop scallop was continuously distributed, and their shapes were relatively similar. It is unrealistic to realize the identification of chromosomes simply by karyotype analysis; and the identification of chromosomes is very important for promoting the study of scallop cytogenetics and Genetic breeding work is of great significance. [0003] I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888
Inventor黄晓婷杨祖晶包振民陆维胡丽萍李晅廖欢
OwnerOCEAN UNIV OF CHINA