Application of MG132 as vaccine production synergist and stabilizing agent

A technology of MG132 and synergist, which is applied in the field of biomedicine, can solve the problems of high production cost, low vaccine production efficiency, and poor stability, and achieve the effect of promoting vaccine production and good vaccine stability

Active Publication Date: 2019-08-06
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, vaccines generally have shortcomings such as low production efficiency and poor stability.
Genetically engineered vaccines based on virus-like particles have been successfully used in the R&

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of MG132 as vaccine production synergist and stabilizing agent
  • Application of MG132 as vaccine production synergist and stabilizing agent
  • Application of MG132 as vaccine production synergist and stabilizing agent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Effect of MG132 on the expression of FMDV structural protein VP3

[0029] 1.1 Experimental steps

[0030] (1) HEK-293T cells were plated on a 12-well plate, and co-transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg) and pCDNA3.1-Flag-VP3 plasmid (1 μg) after 12 hours;

[0031] (2) Add DMSO (50μM, as a control), MG132 (50μM), 3-MA (0.5mg / ml), NH 18h after transfection 4 Cl (25mM), react for 6h;

[0032] (3) After the reaction was completed, the above-mentioned samples were collected, lysed with SDS-loading buffer, and the expression of VP3 protein was detected by WB method.

[0033] 1.2 Experimental results

[0034] The result is as figure 1 As shown, after adding MG132, the expression of FMDV structural protein VP3 was significantly increased, while adding DMSO, 3-MA and NH 4 Cl has no significant effect on the expression of structural protein VP3, indicating that only MG132 can increase the expression of VP3 protein.

Embodiment 2

[0035] Example 2 Effect of MG132 on the expression of structural proteins in FMDV-infected cells

[0036] 2.1 TBK1 - / - Construction of MEFs

[0037] 2.1.1 Experimental steps

[0038] (1) For annealing coupling, mix CRISPR / Cas9 F (CGGCGAGTCAACTCCGGCCA) and R (TGGCCGGAGTTGACTCGCCG) guide sequences (5 μL) at a concentration of 10 μM with 0.5M NaCl (6 μL) and water (24 μL), and place the annealed primers Place in a 95°C water bath for 5 minutes, then take it out and cool down to room temperature naturally;

[0039] (2) According to the instructions, use Fast Digest Bsm BI to cut out the cohesive ends of the pGL-U6-gRNA vector; mix 5 μL of the above-mentioned primers after annealing with 2 μL of the digested vector with T4 ligase, and ligate at room temperature for 30 minutes;

[0040] (3) Mix 5 μL of the ligation product with 50 μL of competent DH5α, heat shock for 30 seconds, and spread on the plate;

[0041] (4) Single clones were selected, sequenced, and plasmids were extra...

Embodiment 3

[0055] Example 3 Effects of MG132 on the Expression of Other Picornaviridae VP3 Proteins

[0056] 3.1 Experimental steps

[0057] (1) 293T cells were plated in 12-well plates, and transfected with pCDNA3.1-HA-TBK1 plasmid (0.25 μg), pCDNA3.1-EV71-Myc-VP3 plasmid (1 μg), and pCDNA3.1-EMCV-Myc after 12 hours - VP3 plasmid (1 μg), and pCDNA3.1-SVV-Myc-VP3 plasmid (1 μg);

[0058] (2) 18 hours after transfection, DMSO (50 μM, as a control) and MG132 (50 μM) were added for 6 hours;

[0059] (3) Collect samples and detect the expression of VP3 protein in each sample.

[0060] 3.2 Experimental results

[0061] Experimental results such as Figure 4 As shown, compared with DMSO, the expression levels of VP3 proteins of picornaviridae viruses EV71, EMCV and SVV were significantly increased after adding MG132.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biomedicine, and particularly relates to an application of MG132 as a vaccine production synergist and a stabilizing agent. The MG132 can increase the expressionlevel of ribonucleic acid virus structural protein VP3, further promotes the assembly of virus-like particles, and can be applied to virus-like particle expression synergists, virus-like particle production synergists and the stabilizing agents of related vaccines to promote vaccine production and improve vaccine stability.

Description

technical field [0001] The invention belongs to the field of biomedicine, and specifically relates to the application of MG132 as a vaccine production synergist and stabilizer. Background technique [0002] Picornaviridae is a family consisting of the smallest group of RNA viruses, mainly including enterovirus, rhinovirus, cardiovirus and aphth virus. Wherein foot-and-mouth disease belongs to the genus Aphthus, and is an important disease that infects cloven-hoofed animals caused by foot-and-mouth disease virus. , composed of structural proteins VP1-VP4. The outbreak of foot-and-mouth disease will restrict the trade of animals and their products, causing serious economic and social impacts. [0003] At present, vaccination is an effective method for specific prevention of foot-and-mouth disease (FMD). Conventional vaccines such as FMD attenuated vaccine and inactivated vaccine have good immunogenicity and play an important role in the prevention and control of FMD. At pre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N7/00C07K14/09C07K14/085A61K47/18
CPCA61K47/18C07K14/005C12N7/00C12N2770/32122C12N2770/32222C12N2770/32322
Inventor 郑海学李丹杨文萍张敬茹毅郝荣增张克山田宏曹伟军刘湘涛
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap