A kind of Saccharomyces cerevisiae engineered strain with high pyruvic acid production and fermentation method thereof
A technology of Saccharomyces cerevisiae and Saccharomyces cerevisiae, which is applied in the field of Saccharomyces cerevisiae engineering strains and its fermentation, which can solve the problems of insufficient pyruvic acid production, long fermentation cycle, increased difficulty of fermentation control and fermentation cost, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Construction of △pdc1△pdc5△pdc6 three-gene-deficient strain
[0037] The construction of high-yield pyruvate Saccharomyces cerevisiae engineering strains comprises the following steps:
[0038] 1) Construction of △pdc6-deficient Saccharomyces cerevisiae engineering strain
[0039] The primers for Saccharomyces cerevisiae pdc6 gene knockout component were designed as follows:
[0040] upstream primer
[0041] GAATTGATCTGTATCTGCACCTAGATCGATTTGATTACAGTTCGTACGCTGCAGGTCGA
[0042] downstream primer
[0043] GTAACATGCGAATTGCGTAATTCACGGCGATAACGTAGGCATAGGCCACTAGTGGAT CT
[0044] Utilizing the upstream and downstream primers, using the plasmid pUG6 as a template, PCR amplified to obtain a knockout component fragment containing the upstream and downstream homology arms of the pdc6 open reading frame (ORF) and the resistance selection marker gene KamX, and the above-mentioned The knockout component fragments were respectively introduced into XY-49-MATa and XY-49-MA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com