Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of Saccharomyces cerevisiae engineered strain with high pyruvic acid production and fermentation method thereof

A technology of Saccharomyces cerevisiae and Saccharomyces cerevisiae, which is applied in the field of Saccharomyces cerevisiae engineering strains and its fermentation, which can solve the problems of insufficient pyruvic acid production, long fermentation cycle, increased difficulty of fermentation control and fermentation cost, etc.

Active Publication Date: 2022-05-20
GUANGXI ACAD OF SCI
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, most of the starting Saccharomyces cerevisiae strains used in the literature reports are auxotrophic. In the process of using synthetic medium for fermentation, additional nutrients such as essential amino acids need to be added, which increases the difficulty of fermentation control and fermentation costs; In addition, the obtained Engineering strains still have problems such as insufficient pyruvate production and too long fermentation cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Saccharomyces cerevisiae engineered strain with high pyruvic acid production and fermentation method thereof
  • A kind of Saccharomyces cerevisiae engineered strain with high pyruvic acid production and fermentation method thereof
  • A kind of Saccharomyces cerevisiae engineered strain with high pyruvic acid production and fermentation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Construction of △pdc1△pdc5△pdc6 three-gene-deficient strain

[0037] The construction of high-yield pyruvate Saccharomyces cerevisiae engineering strains comprises the following steps:

[0038] 1) Construction of △pdc6-deficient Saccharomyces cerevisiae engineering strain

[0039] The primers for Saccharomyces cerevisiae pdc6 gene knockout component were designed as follows:

[0040] upstream primer

[0041] GAATTGATCTGTATCTGCACCTAGATCGATTTGATTACAGTTCGTACGCTGCAGGTCGA

[0042] downstream primer

[0043] GTAACATGCGAATTGCGTAATTCACGGCGATAACGTAGGCATAGGCCACTAGTGGAT CT

[0044] Utilizing the upstream and downstream primers, using the plasmid pUG6 as a template, PCR amplified to obtain a knockout component fragment containing the upstream and downstream homology arms of the pdc6 open reading frame (ORF) and the resistance selection marker gene KamX, and the above-mentioned The knockout component fragments were respectively introduced into XY-49-MATa and XY-49-MA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered strain of Saccharomyces cerevisiae with high pyruvic acid production. The strain is classified and named as Saccharomyces cerevisiae XY-156A, which is preserved in the General Microbiology Center of the China Microorganism Culture Collection and Management Committee, and the preservation number is CCTCC M 2019129. The genetically engineered strain of Saccharomyces cerevisiae XY-156A of the present invention can utilize a large amount of glucose to ferment and produce pyruvic acid, and after 76 hours of fed-batch fermentation, the pyruvate concentration in the fermentation broth can reach 105 g / L, and the pyruvic acid yield is 0.5g / g glucose has potential application value in pyruvate fermentation production.

Description

technical field [0001] The invention relates to a high-pyruvate-producing Saccharomyces cerevisiae engineering strain and a fermentation method thereof, belonging to the technical field of fermentation engineering. Background technique [0002] Pyruvic acid (pyruvic acid), a light yellow to yellow transparent liquid, widely exists in the human body, animals, plants and microorganisms, and is an important intermediate product in the process of cell metabolism; pyruvic acid and its salts serve as an important platform Compounds are widely used in chemical, pharmaceutical, agricultural chemicals, food health care and other fields. For example, pyruvic acid and its salts are precursors for the synthesis of important compounds such as L-tyrosine, L-tryptophan, vitamin B6, N-acetyl-D-neuraminic acid, (R)-acetylbenzyl alcohol; In addition, it has potential applications in human health care such as anti-fatigue, increasing endurance, lowering blood fat, and losing weight. [0003]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/19C12N15/81C12N1/36C12P7/40C12R1/865
CPCC12N9/88C12Y401/01001C12N15/81C12N1/36C12P7/40Y02E50/10
Inventor 李亿王青艳秦艳朱婧梁戈彭龙云潘丽霞
Owner GUANGXI ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products