Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of drug for increasing iron transport from ventral hippocampus to medial prefrontal cortex in preparation of drugs for treating neuropsychiatric diseases

A neuropsychiatric disease, cortical layer technology, applied in the field of medical biology, can solve problems such as iron depletion

Active Publication Date: 2019-08-30
SOUTHERN MEDICAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overexpression of FPN in tissue culture cells leads to intracellular iron depletion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of drug for increasing iron transport from ventral hippocampus to medial prefrontal cortex in preparation of drugs for treating neuropsychiatric diseases
  • Application of drug for increasing iron transport from ventral hippocampus to medial prefrontal cortex in preparation of drugs for treating neuropsychiatric diseases
  • Application of drug for increasing iron transport from ventral hippocampus to medial prefrontal cortex in preparation of drugs for treating neuropsychiatric diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Pharmacological / pharmacological experimental research on the brain iron transport pathway

[0046] 1. Iron chelation experiment in specific brain regions:

[0047] After anesthetized by intraperitoneal injection of 4% chloral hydrate, the mice were fixed on the mouse adapter of the stereotaxic instrument, and the eyes were kept moist with eye ointment. After cutting off the hair, disinfect the skin, cut the head skin along the midline, remove the surface connective tissue to expose the skull, adjust the position and direction of the anterior and posterior bregma, and locate according to the following coordinates.

[0048] Ventral hippocampus (AP: -3.28mm; ML: ±3.25mm; DV: -4.50mm)

[0049] Medial prefrontal cortex (AP:+1.78mm; ML:±0.3mm; DV:-2.75mm)

[0050] Substantia nigra (AP:-3.40mm; ML:±1.5mm; DV:-4.50mm)

[0051] Dorsal hippocampus (AP:-1.70mm; ML:±1.0mm; DV:-2.00mm)

[0052] Striatum (AP:+1.10mm; ML:±1.5mm; DV:-3.50mm)

[0053] Globus pallidum (AP...

Embodiment 2

[0069] Example 2: Anti-anxiety pharmacodynamic / pharmacological experimental research on enhancing iron transport from ventral hippocampus to medial prefrontal cortex

[0070] 1. Overexpression of iron transporter in the ventral hippocampus increases iron transport in the dorsal hippocampus → medial prefrontal cortex:

[0071] Firstly, retrovirus was injected in the medial prefrontal cortex to mark the neurons projecting to the upper level of the medial prefrontal cortex, and two weeks later, a virus overexpressing ferroportin was injected in the ventral hippocampus to make the neurons projecting to the medial prefrontal cortex Neurons in the ventral hippocampus overexpressed iron transporter, and iron concentrations in behavioral and brain regions were measured two weeks later.

[0072] Retrovirus: AAV2-RETRO-hSyn-cre

[0073] Titer: 2.28E+13v.g / ml

[0074] Production company: brainVTA, China

[0075] Item No.: PT-0136

[0076] Virus overexpressing ferroportin (human origi...

Embodiment 3

[0097] Example 3: Anxiolytic Pharmacological / Pharmacological Experimental Study on Reducing Iron Transport from Ventral Hippocampus → Medial Prefrontal Cortex

[0098] Similar to the method used in Example 2, the expression of ferroportin was disturbed in neurons in the ventral hippocampus projecting to the medial prefrontal cortex layer, and the overexpressed transferrin was detected by open field test, black and white box test, elevated test, etc. Behaviors such as exercise and anxiety in protein mice.

[0099] Retrovirus: AAV2-RETRO-hSyn-cre

[0100] Titer: 2.28E+13v.g / ml

[0101] Production company: brainVTA, China

[0102] Item No.: PT-0136

[0103] Interfering virus (mouse origin, interfering with the expression of ferroportin): AAV2 / 8-CMV-DIO-EGFP-FPN-shRNA

[0104] Titer: 2.15E+13v.g / ml

[0105] Production company: Obio Technology, China

[0106] Construct gene sequence: Gene ID: NM_016917.FPN shRNA: CAGACATGAATGCTACCATTA

[0107] Interference control virus: AAV...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an application of a drug for increasing iron transport from ventral hippocampus to medial prefrontal cortex in preparation of drugs for treating neuropsychiatric diseases. Inventors enable human-source ferroportin to be over-expressed in neurons projected to the ventral hippocampus of the medial prefrontal cortex. Results show that iron concentration in the medial prefrontal cortex is significantly increased after 14 days of overexpression of viruses, suggesting that the method can increase the iron transport from the ventral hippocampus to the medial prefrontalcortex. Compared with control mice, the over-expression mice are increased in total motion distance, increased in time in a middle of an open field, decreased in time in a black box, and increased intime on elevated open arm, and have anti-anxiety behaviors. After successful modeling, compared with the normal control, the mice with the increased iron transport after an injection of deferiprone are increased in the time on the elevated open arm and increased in number of times entering the open arm, and have the anti-anxiety behaviors. In summary, the increase of the iron transport from the ventral hippocampus to the medial prefrontal cortex has effects of preventing and treating anxiety.

Description

[0001] Technical field: [0002] The invention belongs to the field of medical biology, and in particular relates to the application of changing intracerebral iron transport in the preparation of medicines for treating neuropsychiatric diseases. [0003] Background technique: [0004] Mental illnesses include: depression, anxiety, bipolar disorder, schizophrenia and other psychosis, dementia, intellectual disability and developmental disabilities including autism. The burden of mental disorders continues to increase in all countries of the world, with significant health impacts and significant social, human rights and economic consequences. [0005] Iron is an essential trace element for the human body and participates in many important metabolic processes in the body: the transportation of blood oxygen, the oxidation reaction in mitochondria, the synthesis of proteins, the composition of coenzymes in biochemical reactions, etc. Iron in the brain is taken up from the periphery...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61P25/00A61P25/22
CPCA61K45/00A61P25/00A61P25/22
Inventor 朱心红朱旻桢曾元宁王卓
Owner SOUTHERN MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More