Application of male sterility gene osdaf1 and method for restoring male sterility in rice
A male sterility gene and male sterility technology, which can be applied in application, genetic engineering, plant genetic improvement, etc., can solve the limitation of the relationship between restorer lines and maintainer lines, complex seed superiority performance of three-line hybrid rice, and difficulty in screening excellent combinations. And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, the method for the creation of rice male sterile lines
[0039] 1.1 Creation of Osdaf1-1 rice male sterile line
[0040] In this example, the male sterile mutant Osdaf1-1 of the japonica background wild-type rice Wuyujing 7 (also known as 9522) was obtained by conventional genetic engineering methods such as RNA interference or sequence variation.
[0041] 1.2 Cloning of rice fertility control protein gene
[0042] Using the rice gene positional cloning (map-based cloning or position cloning) population clear to those skilled in the art, it was located between the two BACs AP004771 and AP004852 on chromosome 2 according to molecular markers, about 4188kb. On this basis, using high-throughput sequencing and RGAP (Rice Genome Annotation Project) website to annotate and analyze the genes in this region, sequencing confirmed that one of the rice male reproductive development control proteins, OsDAF1 gene, was mutated ( figure 2 A).
[0043] 1.3 Point mut...
Embodiment 2
[0069] Embodiment 2, the purposes of Osdaf1 mutant in rice seed production
[0070] The Osdaf1 mutant was used as the female parent to cross the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. In the F2 generation, plants with both male sterility and sterility characteristics were screened, and the screened plants were crossed with the maintainer lines corresponding to the original sterile parents. In the F2 generation, the plants with both male sterility and sterility characteristics were screened again and crossed with the maintainer line. After multiple generations of cross screening, a new male sterile line was obtained, which was suitable as the female parent in the hybrid combination.
Embodiment 3
[0071] Embodiment 3, the method for recovering Osdaf1 mutant male sterility traits
[0072] Transferring the genome nucleotide sequence encoding the OsDAF1 gene into the mutant Osdaf1 mutant plant can restore the mutant to the wild-type phenotype. Genomic DNA was extracted from leaves of wild-type 9522 seedlings as a template, and primers were used:
[0073] OsDAF1gDNAF:5'GCAGGCATGC AAGCTT CTCAACATCTGGCTTCAGTTGA 3' (SEQ ID NO. 13)
[0074] OsDAF1gDNAR:5'ATTCGAGCT GGTCACC AGAGAGCAGGTAATATCTGGAAT 3' (SEQ ID NO. 14)
[0075] A 7234bp genome sequence fragment of the OsDAF1 gene as shown in SEQ ID NO.15 was amplified; the fragment was inserted into a binary vector for transforming rice through the In-Fusion transformation system of Dalian Bao Biological Company In the pCAMBIA1301 vector; the sequencing verification is correct, the vector is introduced into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by electric shock, and OsDAF1 is obtained to complement an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More