Gene detection method of amount of individual folic acid replenisher

A detection method and individual technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of long cycle, increased risk of DS children, and complicated operation.

Inactive Publication Date: 2019-09-17
QINGHAI UNIVERSITY
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2000, HOBBS discovered and confirmed that another key enzyme of folic acid metabolism, methionine synthesis reductase (MTRR) gene A66G mutation is another maternal risk factor for DS, MTRRA66G homozygous mutation combined with at least one MTHFR C667T mutation Locus also increases the risk of having a child with DS
[0012] The detection of genes related to folic acid metabolism already exists in the prior art. The common methods are sequencing method or fluorescent quantitative PCR method.
In addition, in the prior art, it is only a simple test for the presence of genotype mutations in patients with folic acid deficiency. For the test results of different genotypes, it is rare to give follow-up treatment or supplementary suggestions for different genotypes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection method of amount of individual folic acid replenisher
  • Gene detection method of amount of individual folic acid replenisher
  • Gene detection method of amount of individual folic acid replenisher

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Sample collection and DNA template preparation

[0046] 1) Use oral swabs to collect the oral epithelial cells of the person to be tested. The method is to insert the swab into the oral cavity so that the head of the swab fully contacts the mucous membranes on the inside of the cheek and the upper and lower gums, and rubs up and down with the force of brushing teeth, while rotating the swab. Let the swab head fully touch the oral mucosa, and repeat this action for 1 minute.

[0047] 2) Using the standard buccal swab DNA extraction kit and corresponding steps, place the swab stained with buccal cells in 800 μL of normal saline, rinse for 20 seconds to make the cells fall off completely, stick to the wall of the centrifuge tube and squeeze dry the swab. For liquid, centrifuge at 12,000rpm for 5min.

[0048] 3) Discard 700 μL of supernatant, and the remaining 100 μL of supernatant, fully shake and mix for 15 seconds, add 200 μL of lysate and 20 μL of digestion s...

Embodiment 2

[0055] Example 2 Design of primers for rs1801133, rs1801131, rs1805087 and rs1801394 loci

[0056] Specific amplification primers for different types of SNP sites were designed (the two primers differ only in the terminal bases, denoted by F1 and F2 respectively), and the corresponding reverse primers (denoted by R), 3 primer combinations Create a primer master mix. In addition, the 5' ends of the two forward primers are respectively connected with different detection sequences for fluorescence detection. Specific amplification primers are underlined, and detection primer sequences are italicized.

[0057] The primer sequences of the specific 4 sites are as follows:

[0058] MTHFR (rs1801133)

[0059] F1: 5′-GAAGGTGACCAAGTTCATGCT AAAGCTGCGTGATGATGAAATCGA -3', as shown in SEQ ID NO: 1;

[0060] F2: 5′-GAAGGTCGGAGTCAACGGATT AAAGCTGCGTGATGATGAAATCGG -3', as shown in SEQ ID NO: 2;

[0061] R: 5'-TTGAGGCTGACCTGAAGCACTTGA-3', as shown in SEQ ID NO: 3;

[0062] MTHFR (rs180...

Embodiment 3

[0075] Embodiment 3 The establishment of PCR reaction system

[0076] The PCR amplification system includes commercially purchased 2x Mix (including Taq enzyme, 4 kinds of dNTPs, and two probes corresponding to the detection primer sequence of the forward primer). The PCR system is as follows:

[0077] PCR amplification system (10μL):

[0078]

[0079] Table 2: PCR reaction amplification program

[0080]

[0081] Fluorescence reading:

[0082] In an environment below 40°C, read the fluorescence value.

[0083] Interpretation of results:

[0084] For each SNP site, taking the MTHFR gene rs1801133 site as an example, there are three possible distribution types of this site in the population: CC, CT and TT. If a person’s genotype at this site is CC, only F1 primers can amplify normally, and F1 primers have a FAM luminescent group, showing blue fluorescence; if the genotype at this site is TT, only F2 primers can amplify normally Amplification, the F2 primer has a HEX ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene detection method of amount of an individual folic acid replenisher. Through design of a primer for amplifying rs1801133, rs1801131, rs1805087 and rs1801394 sites, 4 SNP sites tightly relevant with metabolism of folic acid in individuals are amplified, and the gene type of individual amplification fragments is further analyzed. According to the difference of idiotype, the quantity demanded of the folic acid is recommended. The method is simple to operate and high in practicability, and is suitable for promotion and use.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a genotype database of genes related to folic acid absorption, metabolism and late reaction, a genotyping method of folic acid related genes, and a detection method for judging folic acid deficiency and excess. Background technique [0002] B vitamins, all water-soluble vitamins, stay in the body for only a few hours and must be replenished every day. Although the "Dietary Guidelines for Chinese Residents 2016" (hereinafter referred to as "Guidelines") gives the recommended supplementary dosage of each B vitamin relative to the Chinese population, the actual needs of each person for B vitamins are different. Simply follow the "Guidelines" The dosage supplement recommended in the Guidelines is not the optimal solution for the individual. [0003] There are many factors that cause individual differences in B vitamin requirements, including gender, age, body weight, etc., among which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156C12Q2600/106
Inventor魏晓星吴穹李长兴王越
OwnerQINGHAI UNIVERSITY