Primer set for identifying chicken parvovirus and bird nephritis virus and application thereof

A parvovirus, chicken identification technology, applied in the direction of microorganisms, recombinant DNA technology, microorganism-based methods, etc.

Inactive Publication Date: 2019-09-17
GUANGXI VETERINARY RES INST
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Compared with conventional PCR, multiplex PCR has the characteristics of simultaneous detection and identification of multiple pathogens, and has unique advantages and high clinical prac

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set for identifying chicken parvovirus and bird nephritis virus and application thereof
  • Primer set for identifying chicken parvovirus and bird nephritis virus and application thereof
  • Primer set for identifying chicken parvovirus and bird nephritis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1, primer design

[0028] Several primers for identifying chicken parvovirus and several primers for identifying avian nephritis virus were obtained through a large number of sequence analysis and alignment. Preliminary experiments are carried out on each primer, and after performances such as sensitivity and specificity are compared, the primer set for identifying chicken parvovirus and avian nephritis virus of the present invention is finally obtained.

[0029] The specific primer pair (primer pair I for short) used to identify chicken parvovirus consists of the following two primers (5'→3'):

[0030] ChPV-F (SEQ.ID.NO.1): aacgtggagagtctcctaaa;

[0031] ChPV-R (SEQ.ID.NO.2): cctgggacctcattctta;

[0032] The specific primer pair (primer pair II for short) for identifying avian nephritis virus consists of the following two primers (5'→3'):

[0033] ANV-F (SEQ.ID.NO.3): ctgtggcaggacccaagtc;

[0034] ANV-R (SEQ. ID. NO. 4): acaaaaggaagaacctgtt.

Embodiment 2

[0035] Embodiment 2, double PCR reaction condition optimization

[0036] 1. Template preparation

[0037] 1. Extract the genomic DNA of chicken parvovirus to obtain sample A.

[0038]2. Extract the total RNA of avian nephritis virus and reverse transcribe it into cDNA to obtain sample B.

[0039] 3. Mix sample A and sample B to obtain a mixed sample.

[0040] 2. Optimization of primer concentration

[0041] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR. Double PCR reaction system (25.0 μL): Contains 12.5 μL of 2×PCR Mix, 2.0 μL of the mixed sample obtained in step 1 (in the 2.0 μL mixed sample, the content of genomic DNA of chicken parvovirus is 1.0 ng, and the content of genomic DNA of avian nephritis virus The content of cDNA is 1.0ng), primer pair I and primer pair II, and finally use ddH 2 O to make up to 25.0 μL.

[0042] According to the concentration of primer pair I and primer pa...

Embodiment 3

[0071] Embodiment 3, specificity

[0072] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).

[0073] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: avian nephritis virus (ANV), Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV H9), and infectious bronchitis virus (IBV).

[0074] 3. Use each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of embodiment 2 as templates, and perform double PCR using the primer combination prepared in embodiment 1. Reaction system for double PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 2.0 μL of template, primer pair I and primer pair II, and ddH 2 O to make up to 25.0 μL. In the reaction system of double PCR, the concentrations of ChPV-F and ChPV-R were both 0.6pmol / μL,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer set for identifying chicken parvovirus and bird nephritis virus and application thereof. The primer set comprises a primer pair I and a primer pair II. The primer pair I is composed of a primer ChPV-F and a primer ChPV-R, and the primer pair II is composed of a primer ANV-F and a primer ANV-R; the primers ChPV-F, ChPV-R, ANV-F and ANV-R have base sequences shown in sequence tables SEQ.ID.NO.1-4. Accordingly, the invention further discloses a corresponding detection and identification method and a corresponding kit. The built dual PCR can be used for rapidly detecting mixed infection of chicken parvovirus and bird nephritis virus, and is suitable for large-batch detection, the cost can be saved, the time can be shortened, contaminations can be reduced, and the high practical value is obtained.

Description

technical field [0001] The invention belongs to the technical field of chicken parvovirus and poultry nephritis virus detection, in particular to a primer set for identifying chicken parvovirus and poultry nephritis virus and its application. Background technique [0002] Chicken parvovirus (Chincken parvovirus, ChPV) is a single-stranded DNA virus that is one of the main pathogens that cause intestinal diseases in chickens. It can cause diarrhea, mental depression, thermoregulation disorders, growth retardation, and increased feed consumption. Acute or chronic intestinal diseases, short stature syndrome, malnutrition syndrome. ChPV is ubiquitous in chicken flocks and mainly affects chicks, but the infection rate of commercial broilers is higher, followed by laying hens or breeders, causing huge economic losses to the chicken industry. Avian Nephritis Virus (ANV) is an enterovirus that mainly affects young chickens, but chickens of all ages are susceptible. ANV can spread ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2537/143
Inventor 谢芝勋张艳芳邓显文刘加波谢志勤张民秀谢丽基罗思思曾婷婷
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap