Primer set for identifying chicken parvovirus and bird nephritis virus and application thereof
A parvovirus, chicken identification technology, applied in the direction of microorganisms, recombinant DNA technology, microorganism-based methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1, primer design
[0028] Several primers for identifying chicken parvovirus and several primers for identifying avian nephritis virus were obtained through a large number of sequence analysis and alignment. Preliminary experiments are carried out on each primer, and after performances such as sensitivity and specificity are compared, the primer set for identifying chicken parvovirus and avian nephritis virus of the present invention is finally obtained.
[0029] The specific primer pair (primer pair I for short) used to identify chicken parvovirus consists of the following two primers (5'→3'):
[0030] ChPV-F (SEQ.ID.NO.1): aacgtggagagtctcctaaa;
[0031] ChPV-R (SEQ.ID.NO.2): cctgggacctcattctta;
[0032] The specific primer pair (primer pair II for short) for identifying avian nephritis virus consists of the following two primers (5'→3'):
[0033] ANV-F (SEQ.ID.NO.3): ctgtggcaggacccaagtc;
[0034] ANV-R (SEQ. ID. NO. 4): acaaaaggaagaacctgtt.
Embodiment 2
[0035] Embodiment 2, double PCR reaction condition optimization
[0036] 1. Template preparation
[0037] 1. Extract the genomic DNA of chicken parvovirus to obtain sample A.
[0038]2. Extract the total RNA of avian nephritis virus and reverse transcribe it into cDNA to obtain sample B.
[0039] 3. Mix sample A and sample B to obtain a mixed sample.
[0040] 2. Optimization of primer concentration
[0041] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR. Double PCR reaction system (25.0 μL): Contains 12.5 μL of 2×PCR Mix, 2.0 μL of the mixed sample obtained in step 1 (in the 2.0 μL mixed sample, the content of genomic DNA of chicken parvovirus is 1.0 ng, and the content of genomic DNA of avian nephritis virus The content of cDNA is 1.0ng), primer pair I and primer pair II, and finally use ddH 2 O to make up to 25.0 μL.
[0042] According to the concentration of primer pair I and primer pa...
Embodiment 3
[0071] Embodiment 3, specificity
[0072] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).
[0073] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: avian nephritis virus (ANV), Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV H9), and infectious bronchitis virus (IBV).
[0074] 3. Use each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of embodiment 2 as templates, and perform double PCR using the primer combination prepared in embodiment 1. Reaction system for double PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 2.0 μL of template, primer pair I and primer pair II, and ddH 2 O to make up to 25.0 μL. In the reaction system of double PCR, the concentrations of ChPV-F and ChPV-R were both 0.6pmol / μL,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



