Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of miR-124-3p and analogues thereof in preparation of anti-breast cancer disease drugs

An anti-breast cancer and analog technology, applied in the field of biomedicine, can solve the problem of weakening the inhibitory effect of downstream target genes

Inactive Publication Date: 2019-09-20
SHANGHAI CHANGHAI HOSPITAL
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many studies have shown that due to the reduction of miR-124-3p content, its inhibitory effect on downstream target genes is weakened, leading to tumorigenesis through different pathways

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-124-3p and analogues thereof in preparation of anti-breast cancer disease drugs
  • Application of miR-124-3p and analogues thereof in preparation of anti-breast cancer disease drugs
  • Application of miR-124-3p and analogues thereof in preparation of anti-breast cancer disease drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Expression analysis and verification of miR-124-3p in breast cancer patients

[0043] Cancer and normal breast tissue samples were collected from 20 patients undergoing breast cancer surgery in Shanghai Changhai Hospital. All patients signed an informed consent form before the operation and were approved by the Ethics Committee of Shanghai Changhai Hospital. Breast cancer tissue and corresponding normal breast tissue specimens were taken during the operation, numbered and quickly put into a liquid nitrogen tank, and transferred to a -80°C refrigerator for storage.

[0044] Real-time fluorescent quantitative PCR: RNA was extracted from breast cancer and normal breast tissue specimens of 20 patients by conventional methods, and miR-124-3p was reverse-transcribed with specific primers of the neck loop structure (sequence: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATTCAC), and sequencing showed reverse The recorded nucleotide sequence of miR-124-3p is: 5'-UAA...

Embodiment 2

[0047] Example 2 miR-124-3p inhibits the proliferation and migration of breast cancer

[0048] Breast cancer cell culture: The human breast cancer cell lines MDA-MB-231, MCF-7 and 293T cells used in the present invention were all purchased from the Cell Bank of the Type Culture Collection Committee of the Chinese Academy of Sciences, and were prepared with 10% inactivated fetal bovine serum ( FBS, GIBCO, CA, USA) and double-antibody DMEM medium (Dulbecco's modified Eagle's medium, Invitrogen), cultured in a 37°C constant-temperature humidified incubator containing 5% carbon dioxide. In the medium required for cultivating MCF-7 cells, 20 IU insulin was added to every 100 ml.

[0049] In order to study the biological effects of miR-124-3p downregulation in breast cancer, the applicant commissioned Shanghai Gemma Biopharmaceutical Company to synthesize miR-124-3p mimics (mimics) for high expression of miR-124-3p in vitro. 3p and inhibitor (inhibitor) are used to interfere with t...

Embodiment 3

[0057] Example 3, miR-124-3p directly targets the expression of the regulatory molecule MGAT5

[0058] The present invention explores the target molecule of miR-124-3p action.

[0059] In the study of the present invention, the target point of its action was first analyzed by TargetScan (www.targetscan.Org) online software, combined with the aforementioned experimental results, it was speculated that MGAT5 may be the target point for miR-124-3p to exert anti-tumor effects, and miR-124-3p Schematic diagram of paired binding to MGAT5 target sites as shown in Figure 4 a. By constructing the dual fluorescent reporter gene expression vector of the above molecules, we found that miR-124-3p has a conserved target site in the 3'-UTR region of MGAT5.

[0060] 293T cells (5×10 3 ) into 96-well plates, and when the cells reached the logarithmic growth phase, 80ng of the constructed MGAT5 3'-UTR-WT, MGAT5 3'-UTR-MUT, GP-miRGLO and 8ng of miR-124-3p mimics, mimicsNC , co-transfected w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of miR-124-3p and analogues thereof in preparation of anti-breast cancer disease drugs. The miR-124-3p has a sequence of 5'-UAAGGCACGCGGUGAAUGCCAA-3'. Experiments prove that the expression of the miR-124-3p is significantly inhibited during the occurrence of breast cancer; with restoring of the expression of the miR-124-3p, the proliferation and migration of breast cancer cells can be inhibited by targeting adjustment of the expression of MGAT5, and thus an anti-tumor role is played. A new molecular marker is provided for diagnosis of breast cancer and a new potential molecular target is provided for clinical treatment.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to the application of miR-124-3p and its analogues in the preparation of anti-breast cancer medicines. Background technique [0002] Breast cancer is a malignant tumor that seriously endangers women's health worldwide. According to China's cancer statistics published in 2015, the most common malignant tumor in women is breast cancer, which accounts for 15% of all female cancers and is the most common cause of cancer death in women under the age of 45. According to the latest statistics in the United States in 2019, breast cancer ranks first among new cancers in women, accounting for 30%, and its mortality rate is second only to lung cancer at 15%. The current clinical treatment of breast cancer is dominated by individualized treatment. The development of DNA chip technology on the molecular level of breast cancer has made the breast cancer classification system based...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7105A61P15/14A61P35/00C12Q1/6886G01N21/64
CPCA61K31/7105A61P15/14A61P35/00C12Q1/6886C12Q2600/158C12Q2600/178G01N21/6428G01N21/6458
Inventor 胡薇闫桂玲詹璐
Owner SHANGHAI CHANGHAI HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products