Application of miR-124-3p and analogues thereof in preparation of anti-breast cancer disease drugs
An anti-breast cancer and analog technology, applied in the field of biomedicine, can solve the problem of weakening the inhibitory effect of downstream target genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Expression analysis and verification of miR-124-3p in breast cancer patients
[0043] Cancer and normal breast tissue samples were collected from 20 patients undergoing breast cancer surgery in Shanghai Changhai Hospital. All patients signed an informed consent form before the operation and were approved by the Ethics Committee of Shanghai Changhai Hospital. Breast cancer tissue and corresponding normal breast tissue specimens were taken during the operation, numbered and quickly put into a liquid nitrogen tank, and transferred to a -80°C refrigerator for storage.
[0044] Real-time fluorescent quantitative PCR: RNA was extracted from breast cancer and normal breast tissue specimens of 20 patients by conventional methods, and miR-124-3p was reverse-transcribed with specific primers of the neck loop structure (sequence: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATTCAC), and sequencing showed reverse The recorded nucleotide sequence of miR-124-3p is: 5'-UAA...
Embodiment 2
[0047] Example 2 miR-124-3p inhibits the proliferation and migration of breast cancer
[0048] Breast cancer cell culture: The human breast cancer cell lines MDA-MB-231, MCF-7 and 293T cells used in the present invention were all purchased from the Cell Bank of the Type Culture Collection Committee of the Chinese Academy of Sciences, and were prepared with 10% inactivated fetal bovine serum ( FBS, GIBCO, CA, USA) and double-antibody DMEM medium (Dulbecco's modified Eagle's medium, Invitrogen), cultured in a 37°C constant-temperature humidified incubator containing 5% carbon dioxide. In the medium required for cultivating MCF-7 cells, 20 IU insulin was added to every 100 ml.
[0049] In order to study the biological effects of miR-124-3p downregulation in breast cancer, the applicant commissioned Shanghai Gemma Biopharmaceutical Company to synthesize miR-124-3p mimics (mimics) for high expression of miR-124-3p in vitro. 3p and inhibitor (inhibitor) are used to interfere with t...
Embodiment 3
[0057] Example 3, miR-124-3p directly targets the expression of the regulatory molecule MGAT5
[0058] The present invention explores the target molecule of miR-124-3p action.
[0059] In the study of the present invention, the target point of its action was first analyzed by TargetScan (www.targetscan.Org) online software, combined with the aforementioned experimental results, it was speculated that MGAT5 may be the target point for miR-124-3p to exert anti-tumor effects, and miR-124-3p Schematic diagram of paired binding to MGAT5 target sites as shown in Figure 4 a. By constructing the dual fluorescent reporter gene expression vector of the above molecules, we found that miR-124-3p has a conserved target site in the 3'-UTR region of MGAT5.
[0060] 293T cells (5×10 3 ) into 96-well plates, and when the cells reached the logarithmic growth phase, 80ng of the constructed MGAT5 3'-UTR-WT, MGAT5 3'-UTR-MUT, GP-miRGLO and 8ng of miR-124-3p mimics, mimicsNC , co-transfected w...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com