C. praecox CpUFO gene as well as coded protein and application thereof
A kind of wax plum and protein technology, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Cloning of embodiment 1 Wintersweet CpUFO gene
[0034] Design specific primers based on the obtained cDNA sequence. The upstream and downstream primers contain the complete ORF sequence. The primer sequences are as follows:
[0035] Table 1 CpUFO full-length PCR primers
[0036] Primer name Primer sequence (5'-3') CpUFO-F TTGGAGAAGAAGGAGAGACAAAACCC CpUFO-R GGCTTTCACAATCAACATACACACC
[0037] The first-strand cDNA synthesized by reverse transcription was used as a template, and PCR amplification was carried out with CpUFO-specific primers.
[0038] The results of PCR amplification of the open reading frame of the wax plum CpUFO gene were detected by electrophoresis, and the results showed that the target band was specific ( figure 1 ). The PCR product was cloned into the pMD19-T vector, transformed into Escherichia coli, detected with CpUFO-F (10 μM) and CpUFO-R (10 μM) specific primers, and the single clones detected by PCR as positive w...
Embodiment 2
[0045] Example 2 Analysis of the expression characteristics of Wintersweet CpUFO gene
[0046] The wintersweet material used in this experiment is Chimonanthus praecox. The stems, leaves, fruits, and flower organs used were all collected from adult wintersweet plants, which were planted on the campus of Southwest University, and the above wintersweet plants were routinely managed.
[0047] Design and synthesis of primers for real-time fluorescence quantitative PCR: Actin and Tublin genes of Chimera japonica were selected as dual internal reference genes for real-time fluorescence quantification of CpUFO gene of Chimera japonica, and primers specific for the internal reference gene and target gene CpUFO were designed using Primer Premier 5.0 software. It was then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. for synthesis. The primer sequences are shown in Table 2. All primers in this study were designed by Primer Premier 5.0 software and synthesized by Beijing Liuhe H...
Embodiment 3
[0053] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpUFO Gene in Arabidopsis
[0054] Combining the restriction enzyme cutting sites and distribution characteristics contained in the CpUFO gene ORF box sequence itself and the characteristics of the multiple cloning sites contained in the plant overexpression vector pCAMBIA1300 used, the most suitable enzymes KpnI and SalI were selected and used on the original specific primers. Restriction sites and their corresponding protective bases are added downstream to amplify the coding region of the CpUFO gene carrying suitable restriction sites and clone it into the multiple cloning site of the plant expression vector. The primer names and sequences are as follows:
[0055] The underlined part is the protective base, and the square part is the Kpn I restriction site);
[0056] The underlined part is the protected base, and the boxed part is the Sal I restriction site).
[0057]Clone the open read...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


