Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wintersweet cpufo gene and its encoded protein and application

A protein, wax plum technology, applied in application, genetic engineering, plant genetic improvement and other directions

Active Publication Date: 2021-02-19
SOUTHWEST UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although ufo mutants do not affect leaf traits, in Arabidopsis, ectopic expression of UFO leads to serrated leaves in Arabidopsis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wintersweet cpufo gene and its encoded protein and application
  • Wintersweet cpufo gene and its encoded protein and application
  • Wintersweet cpufo gene and its encoded protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Cloning of embodiment 1 Wintersweet CpUFO gene

[0034] Design specific primers based on the obtained cDNA sequence. The upstream and downstream primers contain the complete ORF sequence. The primer sequences are as follows:

[0035] Table 1 CpUFO full-length PCR primers

[0036] Primer name Primer sequence (5'-3') CpUFO-F TTGGAGAAGAAGGAGAGACAAAACCC CpUFO-R GGCTTTCACAATCACATACACACC

[0037] The first-strand cDNA synthesized by reverse transcription was used as a template, and PCR amplification was carried out with CpUFO-specific primers.

[0038] The results of PCR amplification of the open reading frame of the wax plum CpUFO gene were detected by electrophoresis, and the results showed that the target band was specific ( figure 1 ). The PCR product was cloned into the pMD19-T vector, transformed into Escherichia coli, detected with CpUFO-F (10 μM) and CpUFO-R (10 μM) specific primers, and the single clones detected by PCR as positive we...

Embodiment 2

[0045] Example 2 Analysis of the expression characteristics of Wintersweet CpUFO gene

[0046] The wintersweet material used in this experiment is Chimonanthus praecox. The stems, leaves, fruits, and flower organs used were all collected from adult wintersweet plants, which were planted on the campus of Southwest University, and the above wintersweet plants were routinely managed.

[0047] Design and synthesis of primers for real-time fluorescence quantitative PCR: Actin and Tublin genes of Chimera japonica were selected as dual internal reference genes for real-time fluorescence quantification of CpUFO gene of Chimera japonica, and primers specific for the internal reference gene and target gene CpUFO were designed using Primer Premier 5.0 software. It was then sent to Beijing Liuhe Huada Gene Technology Co., Ltd. for synthesis. The primer sequences are shown in Table 2. All primers in this study were designed by Primer Premier 5.0 software and synthesized by Beijing Liuhe H...

Embodiment 3

[0053] Example 3 Genetic Transformation and Functional Analysis of Wintersweet CpUFO Gene in Arabidopsis

[0054] Combining the restriction enzyme cutting sites and distribution characteristics contained in the CpUFO gene ORF box sequence itself and the characteristics of the multiple cloning sites contained in the plant overexpression vector pCAMBIA1300 used, the most suitable enzymes KpnI and SalI were selected and used on the original specific primers. A restriction site and its corresponding protective bases are added downstream to amplify the CpUFO gene coding region carrying a suitable restriction site and clone it into the multiple cloning site of the plant expression vector. The primer names and sequences are as follows:

[0055] The underlined part is the protective base, and the square part is the Kpn I restriction site);

[0056] The underlined part is the protected base, and the boxed part is the Sal I restriction site).

[0057]Clone the open reading fra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant molecular biology, in particular to the wintersweet CpUFO gene and its encoded protein and application. The invention obtains the cDNA sequence of Wintersweet CpUFO through gene cloning, the cDNA sequence of the gene is 1753bp in full length, includes a complete open reading frame (ORF) of 1212bp, and encodes 403 amino acids. Phenotype observation after the gene was transformed into Arabidopsis thaliana showed that the time of bud development, scaping, first flower and first fruit pod of transgenic lines were earlier than those of WT plants; the number of rosette leaves and the total number of leaves were both Fewer plants than WT, earlier flowering time. The flower organs were observed and found that the pistil column length of CpUFO transgenic Arabidopsis was longer than that of wild-type Arabidopsis at the same flowering stage. It shows that the CpUFO gene of Wintersweet can promote the flowering of the plant and also affect the flower organs of the plant.

Description

technical field [0001] The invention belongs to the field of plant molecular biology, and specifically relates to a wintersweet CpUFO gene, its encoded protein and application. Background technique [0002] Wintersweet (C. praecox (L.) Link), which belongs to the genus Chimonanthus Lindl. of the family Calycanthaceae, is a rare and precious fragrant and ornamental tree species unique to my country. Wintersweet is a rare plant that blooms in the true sense of the word and is fragrant and pleasant. Because the flowers bloom in the severe winter, it has been given the meaning of being proud of the frost and fighting the snow and facing difficulties by ancient and modern cultural people. It is a symbol of literati, The aesthetic taste of refined scholars and the representatives and symbols of many excellent virtues of the working people who are persevering and courageous, have been loved by the people of the country since ancient times. [0003] China is the main origin of Wint...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/827
Inventor 李志能李先源余尚妍眭顺照李名扬
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com