Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Adelphocoris suturalis reproduction related protein PG, and coding gene, dsRNA interference sequence and application thereof

A technology of Lygus melanogaster and interference sequence, which is applied in the field of agricultural biology and can solve the problems such as the unreported role of pepsinogen

Active Publication Date: 2019-11-22
HUAZHONG AGRI UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the research on pepsinogen is mainly the relationship between its content and the health of the stomach, and there is no report on the role of pepsinogen in the process of insect reproduction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adelphocoris suturalis reproduction related protein PG, and coding gene, dsRNA interference sequence and application thereof
  • Adelphocoris suturalis reproduction related protein PG, and coding gene, dsRNA interference sequence and application thereof
  • Adelphocoris suturalis reproduction related protein PG, and coding gene, dsRNA interference sequence and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning and Analysis of the Lygus pepsinogen Gene in Example 1

[0030] Weigh 30 mg of Lygus melanogaster samples into 1.5 ml enzyme-free tubes, pre-cool with liquid nitrogen, grind the females with a grinding rod, and extract total RNA using the TRIzol method.

[0031] The total RNA extracted above was synthesized into a cDNA template using the PrimeScriptTM RT Master Mix (perfect real time) kit.

[0032] The primers designed and synthesized are as follows:

[0033] Upstream primer sequence PG-F: 5'-TGATCTAAGTGTGATCAGTAAAGATGATTT-3',

[0034] Downstream primer sequence PG-R: 5'-GTTCCATAAAGTATTTAATTCGCTAAAGTCG-3'.

[0035] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers PG-F and PG-R. 1% agarose electrophoresis to detect PCR products, ethidium bromide (EB) staining, observe the electrophoresis results under ultraviolet light, detect the correct fragments, and use the DNA gel recovery kit to purify and recove...

Embodiment 2

[0038] Example 2 Silencing efficiency of the gene after injection of dsRNA of the pepsinogen gene and its influence on the fecundity of Lygus melanogaster

[0039] 2.1 Preparation of dsRNA template

[0040] According to the pepsinogen gene sequence obtained in Example 1, design specific amplification primers (5'-end plus T7 promoter sequence), for the amplification of the dsRNA fragment of pepsinogen gene, the specific primers of design are as follows:

[0041] Upstream primer sequence dsPG-F: CCCGAACAACTGTGGTGGAA

[0042] Downstream primer sequence dsPG-R: TTGGCTTGGCGATCCAAAATC.

[0043] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers dsPG-F and dsPG-F, the PCR product was detected by 1% agarose electrophoresis, stained with ethidium bromide (EB), and the electrophoresis results were observed under ultraviolet light. Gel and use the DNA gel extraction kit to purify and recover the target fragment. The PCR produc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular massaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of agricultural biotechnology, and in particular, relates to an adelphocoris suturalis reproduction related protein PG, and a coding gene, a dsRNA interference sequence and an application thereof. The adelphocoris suturalis reproduction related protein PG has the amino acid sequence shown in SEQ ID NO.1. The interference sequence of a pepsinogen gene is injectedto adelphocoris suturalis, so the number of eggs in an ovary of the adelphocoris suturalis is significantly reduced, the final egg laying amount of the adelphocoris suturalis is inhibited, the declineof the reproductive ability of the adelphocoris suturalis is finally caused, and the development of the population is effectively controlled. The gene and protein can be used for development of transgenic insect-resistant plants and biological control of the adelphocoris suturalis.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to the reproduction-related protein PG of Lygus melanogaster and its coding gene, dsRNA interference sequence and application. Background technique [0002] Since the commercialization of Bt cotton in my country, the amount and frequency of pesticide use have been greatly reduced, making mirid bugs rise from secondary pests to major pests. Adelphocoris suturalis belongs to Hemiptera Miridae and is one of the main pests in the cotton planting area of ​​the Yangtze River Basin in my country. It can also harm vegetables, soybeans, and fruit trees. In the prior art, chemical control is mainly used for the prevention and control of Lygus chinensis, but chemical control will produce drug resistance, reduce the control effect, and also pollute agricultural products, air, upper soil and waters, endangering the health and safety of people and animals. ecosystem. In add...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/113A01N57/16A01P7/04
CPCC07K14/43563C12N15/113A01N57/16
Inventor 陈利珍朱邦勤赵景朱俊宇彭捷
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com