Check patentability & draft patents in minutes with Patsnap Eureka AI!

SNP molecular marker related to chicken pink eggshell color depth and application of SNP molecular marker

A molecular marker, eggshell technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of lack of molecular markers, and achieve the effect of reducing feeding costs and improving production efficiency

Active Publication Date: 2019-12-10
JIANGSU INST OF POULTRY SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of molecular marker technology will accurately select for this trait, but there is currently a lack of relevant molecular markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker related to chicken pink eggshell color depth and application of SNP molecular marker
  • SNP molecular marker related to chicken pink eggshell color depth and application of SNP molecular marker
  • SNP molecular marker related to chicken pink eggshell color depth and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Genome-wide association analysis

[0039] (1) Collect the venous blood of the hens of the F2 generation population, and use the standard phenol-chloroform method to extract the genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and the OD 260 / 280 ratio between 1.8 and 2.0 was finally selected as qualified for subsequent experiments. The concentration was uniformly diluted to 50ng / ul for genotyping.

[0040] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip instructions for genotyping and quality control, including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, excluding call rate less than 0.97, deviation from Hardy-Weinberg equilibrium ≤10 -6 SNP markers for BEAGLE v4.0 select R 2 SNPs >0.5 were filled. The remaining 435,867 SNPs and 407 samples of QC were used for subsequent analysis.

[0041](3...

Embodiment 2

[0044] Embodiment 2 The establishment of the detection method of color depth allele of eggshell of powder-shell egg

[0045] (1) A nucleotide fragment of 243bp in the gene PCIF1 gene is amplified by the target fragment primer of the SNP marker site significantly related to the color of the eggshell of the eggshell of the pink-shelled egg, and the upstream and downstream primers of the sequence amplification are:

[0046] Upstream primer pink-F: TCCGTGAAGAAGCCAAGAGA (SEQ ID NO. 1)

[0047] Downstream primer pink-R: ACCATGAAAGACAGCTCCAG (SEQ ID NO. 2)

[0048] (2) PCR amplification:

[0049] In this example, the reagents were obtained by Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangon Company.

[0050] The pure line genomic DNA after 3 generations of breeding of the offspring of Dongxiang green-shelled laying hens and Bailaihang laying hens with pink-shelled eggs was used as the template, and the primers pink-F and pink-R were...

Embodiment 3

[0061] Example 3 Effect analysis of molecular marker SNP rs312882817C>T mutation

[0062] The SNP molecular marker for improving the eggshell color of pink-shelled eggs provided by the invention has effects on the L, a and b values ​​of 32 weeks of age by 13.24%, 15.42% and 10.09% respectively, and the effect on the eggshell color of the other periods is 13.24%, 15.42% and 10.09% respectively The value is also more than 5%. Using the SNP marker to carry out molecular marker assisted selection can significantly reduce the eggshell color of the pink-shelled egg, and speed up the process of selecting the eggshell color of the pink-shelled egg.

[0063] Table 1 Analysis of the effect of SNP markers on eggshell color of pink-shelled eggs of different weeks of age

[0064] %

[0065]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker related to a chicken pink eggshell color depth and belongs to the technical field of molecular markers. An SNP site of the SNP molecular marker is located at the 10544301th site of chromosome 20 of an international chicken reference genome GRCg6a Primary Assembly version, i.e. a 5561th base position of a gene PCIF1, and the base at the position is Cor T. The invention further provides a primer combination for detecting the SNP marker and application of the primer combination. By utilizing the SNP molecular marker and the primer combination, a molecular marker assistant breeding technology for an efficient and accurate chicken pink eggshell color can be established, so that a pink eggshell color breeding method is effectively improved, and development of local laying hen industry is promoted.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to the color depth of chicken powder shell eggs and egg shells and applications thereof. Background technique [0002] Eggshell color has little correlation with laying hens' production performance and egg quality. However, eggshell color is an important factor affecting consumers' choice. Affected by the consumption habits of the Chinese people, pink-shell eggs have always been favored by the market. The price of pink-shell eggs is higher than that of eggs with other shell colors, which can bring higher economic benefits to farmers. Therefore, the breeding of local egg shell color in my country is also more inclined to breeding to pink shell eggs. [0003] In production, eggshell color is mostly selected through the subjective judgment of breeders in the process of subculture selection. The principle of first-reservation and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 王克华曲亮卢建窦套存沈曼曼马猛王星果李尚民李永峰郭军胡玉萍
Owner JIANGSU INST OF POULTRY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More