SNP molecular marker related to chicken pink eggshell color depth and application of SNP molecular marker
A molecular marker, eggshell technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of lack of molecular markers, and achieve the effect of reducing feeding costs and improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Genome-wide association analysis
[0039] (1) Collect the venous blood of the hens of the F2 generation population, and use the standard phenol-chloroform method to extract the genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and the OD 260 / 280 ratio between 1.8 and 2.0 was finally selected as qualified for subsequent experiments. The concentration was uniformly diluted to 50ng / ul for genotyping.
[0040] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip instructions for genotyping and quality control, including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, excluding call rate less than 0.97, deviation from Hardy-Weinberg equilibrium ≤10 -6 SNP markers for BEAGLE v4.0 select R 2 SNPs >0.5 were filled. The remaining 435,867 SNPs and 407 samples of QC were used for subsequent analysis.
[0041](3...
Embodiment 2
[0044] Embodiment 2 The establishment of the detection method of color depth allele of eggshell of powder-shell egg
[0045] (1) A nucleotide fragment of 243bp in the gene PCIF1 gene is amplified by the target fragment primer of the SNP marker site significantly related to the color of the eggshell of the eggshell of the pink-shelled egg, and the upstream and downstream primers of the sequence amplification are:
[0046] Upstream primer pink-F: TCCGTGAAGAAGCCAAGAGA (SEQ ID NO. 1)
[0047] Downstream primer pink-R: ACCATGAAAGACAGCTCCAG (SEQ ID NO. 2)
[0048] (2) PCR amplification:
[0049] In this example, the reagents were obtained by Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangon Company.
[0050] The pure line genomic DNA after 3 generations of breeding of the offspring of Dongxiang green-shelled laying hens and Bailaihang laying hens with pink-shelled eggs was used as the template, and the primers pink-F and pink-R were...
Embodiment 3
[0061] Example 3 Effect analysis of molecular marker SNP rs312882817C>T mutation
[0062] The SNP molecular marker for improving the eggshell color of pink-shelled eggs provided by the invention has effects on the L, a and b values of 32 weeks of age by 13.24%, 15.42% and 10.09% respectively, and the effect on the eggshell color of the other periods is 13.24%, 15.42% and 10.09% respectively The value is also more than 5%. Using the SNP marker to carry out molecular marker assisted selection can significantly reduce the eggshell color of the pink-shelled egg, and speed up the process of selecting the eggshell color of the pink-shelled egg.
[0063] Table 1 Analysis of the effect of SNP markers on eggshell color of pink-shelled eggs of different weeks of age
[0064] %
[0065]
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com