Application of Zearalenone Degrading Enzyme in Hydrolyzing Zearalenone and Its Derivatives

A technology of zearalenone and zearalenol is applied in the application field of zearalenone degrading enzyme in hydrolyzing zearalenone and its derivatives, and can solve the problem of zearalenone degrading enzyme Problems such as poor stability and narrow PH range, to achieve the effects of excellent thermal stability, good stability and outstanding thermal stability

Active Publication Date: 2022-03-15
HUBEI UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the stability of these zearalenone-degrading enzymes is not good, and the pH range of action is relatively narrow, and they are not very suitable for large-scale industrial applications. It is necessary to obtain a degrading enzyme that can overcome these disadvantages and is suitable for large-scale industrial applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Zearalenone Degrading Enzyme in Hydrolyzing Zearalenone and Its Derivatives
  • Application of Zearalenone Degrading Enzyme in Hydrolyzing Zearalenone and Its Derivatives
  • Application of Zearalenone Degrading Enzyme in Hydrolyzing Zearalenone and Its Derivatives

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Preparation and Purification of Zearalenone Degrading Enzyme

[0031] (1) Artificial synthesis of gene sequence

[0032] Entrust Wuhan Jinkairui Bioengineering Co., Ltd. to synthesize the nucleotide sequence shown in SEQ ID NO: 2, and insert the sequence into the plasmid vector pET26b, and save it for future use.

[0033] The sequence of SEQ ID NO:2 is as follows:

[0034] atgtccgccgagagagttagatccaccgttttgactaaggacggtatcaactggtactacgagcaagaaggtactggtccagacttggttttgatcccagatggtttgggtgactgccagatgttcgataagccaatgtccttgattgcctcctccagattcaaggttaccaccttcgatatgccaggtatgtccagatcttctgctgctccaccagaaacctaccaagaggttactggtgagaagttggctacctacatcgacaccttgatggacaagctggacatcactactgcttccgtttggggttgttcttctggtgcttctactgttttggccctgtgtgctaacttcccacacagagttagaaacgctatgccacacgagctgccaactactaatccaccatccattgacaacatccacgaagctgatccagctactttgccagctgctttggctgctactatcagaactatgtctggtggtgaagctgcttgggatgctttgggtcctgaagttcacgatagactgagagccaacaactacgttagatgggcttacggttacccaagaactattccaggttccgctccaa...

Embodiment 2

[0058] Example 2 Using zearalenone as a substrate to verify the function of zearalenone-degrading enzymes

[0059] The enzyme activity unit is defined as the amount of enzyme required to degrade 1 μg of the substrate zearalenone within 1 min as an enzyme activity unit U.

[0060] (1) Optimum temperature

[0061] The Zhd11c pure enzyme solution in Step 5 of Example 1 was diluted with 50 mM Tris-HCl buffer solution of pH 8.0, and the enzyme activity was measured with the diluted enzyme solution. The diluted enzyme solution was recorded as the diluted enzyme solution.

[0062] The composition of solution A: consists of 50 mM, pH 8.0 Tris-HCl buffer solution and zearalenone solution; the final concentration of the substrate zearalenone in the reaction system 0.5 mL is 20.0 μg / ml.

[0063] Experimental group: The reaction system for activity determination is 0.5mL, diluted with 0.45mL solution A and 0.05mL enzyme solution; the pH value of the reaction system is 8.0; mL of chroma...

Embodiment 3

[0086] Example 3 Using β-zearalenol as a substrate to verify the function of zearalenone degrading enzyme

[0087] The enzyme activity unit is defined as the amount of enzyme required to degrade 1 μg of the substrate zearalenone within 1 min as an enzyme activity unit U.

[0088] The diluted enzyme solution described below was obtained by diluting the Zhd11c pure enzyme solution in Step 5 of Example 1 with 50 mM Tris-HCl buffer solution.

[0089] Experimental group: β-zearalenol was used as the substrate (the final concentration of the substrate in the reaction system was 20.0 μg / ml), the activity assay reaction system was 0.5mL, and 0.45mL substrate solution and 0.05mL diluted enzyme solution; the pH value of the reaction system was 8.0; after the reaction system was reacted at an optimum temperature of 40° C. for 10 min, 0.5 mL of chromatographic grade methanol was used to terminate the reaction, and after cooling, the amount of degradation of the substrate was measured usin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the application of a zearalenone degrading enzyme in hydrolyzing zearalenone and its derivatives. The amino acid sequence of the zearalenone degrading enzyme is shown in SEQ ID NO:1. The most suitable natural substrate of the zearalenone-degrading enzyme of the present invention is zearalenone, which has the highest enzyme activity of 70.42U / mg at 45°C and a pH of 8. It has higher degradation activity under pH conditions, better stability under different pH conditions, and excellent thermal stability.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to the application of a zearalenone degrading enzyme in hydrolyzing zearalenone and its derivatives. Background technique [0002] Zearalenone (ZEN) is an estrogen-like mycotoxin produced by Fusarium spp. acid lactone. Under the right environment, crops can be easily infected by Fusarium, which can produce high levels of ZEN and its derivatives, causing food or feed contamination. [0003] The chemical structure of ZEN is similar to natural estrogen, so it and its derivatives can competitively bind with estrogen receptors, thereby affecting the reproductive function of the body, as well as cell apoptosis, teratogenicity, DNA damage, oxidative damage, and immune impact functions and other mechanisms to affect the health of animals and humans. [0004] In view of the hazards of such toxins, the content of zearalenone, etc. in grains, food and feed must be lower than...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/16C12N15/55A23L5/20
CPCC12N9/16A23L5/25
Inventor张桂敏王辉蒋思婧王美星马延和
OwnerHUBEI UNIV