Deinococcus radiodurans-derived P450 monooxygenase mutant and application thereof

A monooxygenase, Deinococcus technology, applied in the biological field, can solve the problems of limited application, low asymmetric hydroxylation activity, low substrate concentration, etc.

Inactive Publication Date: 2020-01-10
ZUNYI MEDICAL UNIVERSITY
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it has been reported that the asymmetric hydroxylation activity of P450 enzymes to 1-chloro-2-phenylethane and its derivatives is low, and the substrate concentration of the reaction is low, which greatly limits the application of the P450 monooxygenase method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deinococcus radiodurans-derived P450 monooxygenase mutant and application thereof
  • Deinococcus radiodurans-derived P450 monooxygenase mutant and application thereof
  • Deinococcus radiodurans-derived P450 monooxygenase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of P450 monooxygenase mutation N190D;

[0035] Design random mutation primers P1 (TAATACGACTCACTATAGGG) and P2 (TCGCTTGGAACATTATTAAC) for mutation, extract the plasmid containing the parental P450 gene as a DNA template, and adjust the Mn in the PCR system 2+ Concentration, error-prone PCR. PCR system (50 μL): 25 μL of 2×TaqPCR MaterMix reagent, 1 μL each of P1 and P2 at a concentration of 100 μM, and MnCl at a concentration of 10 μM 2 Solution 1 μL, template plasmid 1 μL, deionized water 21 μL. PCR program: first step, 95°C / 5min; second step, 98°C / 10s, 55°C / 15s, 72°C / 10min, a total of 30 cycles; third step, 72°C / 20min. After the PCR product was purified, the WHOPPCR strategy was used to amplify the whole plasmid, and the obtained PCR product was transformed into Escherichia coli BL21 (DE3) competent cells by heat shock (42°C, 90s). After revived culture (37°C, 1h), spread evenly on LB solid medium containing kanamycin sulfate antibiotic, and ...

Embodiment 2

[0036] Example 2: Construction of P450 monooxygenase mutation N190F;

[0037] In order to obtain a better mutant at position 190, design a site-directed saturation mutation primer P3 for position 190

[0038] (TCATACCATGACCATG NNK AGCCGTCCGCC) and P4 (CGGACGGCT MNN CATGGTCATGGTATGATGC), extract the whole plasmid of mutant N190D as DNA template, and carry out site-directed saturation mutation PCR. PCR system (50 μL): 10 μL of 5×Plusbuffer reagent, 2 μL each of P1 and P2 at a concentration of 100 μM, 2 μL of template plasmid, 4 μL of dNTP reagent, 0.5 μL of PrimeSTAR DNA polymerase, and 29.5 μL of deionized water. PCR program: first step, 95°C / 5min; second step, 98°C / 10s, 60°C / 5s, 72°C / 10min, a total of 30 cycles; third step, 72°C / 20min. After the PCR product was digested with DpnI, it was directly transformed into E. coli BL21 (DE3) competent cells by heat shock (42°C, 90s). After revived culture (37°C, 1h), spread evenly on LB solid medium containing kanamycin sulfate an...

Embodiment 3

[0039] Example 3: Construction of P450 monooxygenase mutation N190F / V356L / A486E;

[0040] In order to obtain a P450 monooxygenase mutant with higher activity, the next round of protein molecular transformation was carried out on the basis of the P450 monooxygenase mutant D190F. Extract the plasmid of P450 monooxygenase mutant D190F as DNA template, use P1 (TAATACGACTCACTATAGGG) and P2 (TCGCTTGGAACATTATTAAC) as random mutation primers, and adjust the Mn in the PCR system 2+ Concentration, error-prone PCR. PCR system (50 μL): 25 μL of 2×TaqPCR MaterMix reagent, 1 μL of P1 and P2 at a concentration of 100 μM, MnCl at a concentration of 10 μM 2 Solution 1 μL, template plasmid 1 μL, deionized water 21 μL. PCR program: first step, 95°C / 5min; second step, 98°C / 10s, 55°C / 15s, 72°C / 10min, a total of 30 cycles; third step, 72°C / 20min. After the PCR product was purified, the WHOPPCR strategy was used to amplify the whole plasmid, and the obtained PCR product was transformed into Esche...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a deinococcus radiodurans-derived P450 monooxygenase mutant and application thereof in synthesis of (S)-2-chloro-1-phenylethanol chiral beta-halohydrin compounds. The P450 monooxygenase is subjected to several rounds of directed transformation to obtain P450 monooxygenase mutants N190D, N190F and N190F / V356L / A486E with improved asymmetric hydroxylation activity, wherein thecatalytic activity of the P450 monooxygenase mutant N190F / V356L / A486E is increased by 8.5 times that of wild P450 monooxygenase. The whole cell of the N190F / V356L / A486E mutant can be applied to catalysis of a benzylic asymmetric hydroxylation reaction of 1-chloro-2-phenylethane and derivatives thereof, the corresponding (S)-2-chloro-1-phenylethanol chiral beta-halohydrin compounds having the yieldof 88 percent and the optical purity of 98 percent ee can be obtained.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a P450 monooxygenase mutant of Deinococcus radioresistant and its application. Background technique [0002] (S)-2-Chloro-1-phenylethanol chiral β-halohydrin compounds, as important synthetic intermediates, can be used in the preparation of various chiral drugs. For example (S)-2-chloro-1-phenylethanol can be used in the synthesis of antidepressants atomoxetine, fluoxetine and nixoxetine (Tetrahedron: Asymmetry, 2005, 16, 3275-3278), figure 1 shown. Its chemical synthesis method includes following two kinds: (1) obtain the halohydrin of single configuration by kinetic resolution by racemic halohydrin, but its maximum theoretical yield is only 50%; (2) with α- The halogenated ketone compound is used as a substrate, and the chiral β-haloalcohol is prepared through an asymmetric reduction reaction catalyzed by a metal catalyst such as transition metal rhodium, ruthenium, iridium or an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12P7/22
CPCC12N9/0079C12Y114/15004C12P7/22
Inventor万南微陈永正崔海波邓国忠
OwnerZUNYI MEDICAL UNIVERSITY