A kind of preparation method and application of oak bark extract
A kind of technology of oak bark and extract, applied in the field of preparation of oak bark extract
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0025] The invention provides a kind of preparation method of oak bark extract, comprises the following steps:
[0026] 1) extracting and filtering the oak bark and the ethanol solution after mixing, drying the obtained filtrate to obtain a dried product;
[0027] 2) dissolving the dried product obtained in step 1) in water to obtain a mixed solution, and extracting the mixed solution with an equal volume of petroleum ether to obtain a petroleum ether phase and an aqueous phase;
[0028] 3) The aqueous phase obtained in the step 2) is extracted with an equal volume of ethyl acetate to obtain an extract, and the ethyl acetate in the extract is removed and dried to obtain an oak bark extract.
[0029] In the invention, the oak bark is mixed with an ethanol solution, extracted, filtered, and the obtained filtrate is dried to obtain a dried product.
[0030] In the present invention, the particle diameter of described oak bark is preferably 50~70 orders, more preferably 60 orders...
Embodiment 1
[0041] Separation and extraction of oak bark extract:
[0042]Take fresh oak bark, dry it naturally, crush it after drying and pass through a 60-mesh sieve, use 65% ethanol, extract at a temperature of 64°C, have a solid-liquid ratio of 1:29, extract for 90 minutes, and repeat the extraction twice after filtration. The two filtrates were combined, and after cooling, the solvent was evaporated to obtain a dry solid called dried product (hereinafter referred to as QMB-TF), wherein the extraction rate of total flavonoids was 0.647%, and the purity of total flavonoids was 7.16%.
[0043] Take 4.0194g of completely dried QMB-TF, add 25ml of distilled water and stir to dissolve, and slowly add 5ml of distilled water during the stirring process, and treat insoluble matter with ultrasound or heat. First use an equal volume of petroleum ether, shake vigorously for 30 minutes, then stand still for 1.5 hours, then separate the liquids, extract three times, and combine the petroleum ether...
Embodiment 2
[0045] Construction of 15-PGDH (15-hydroxyprostaglandin dehydrogenase) expression system
[0046] 15-PGDH (15-hydroxyprostaglandin dehydrogenase) gene synthesis and target gene amplification
[0047] (1) Search for the nucleotide sequence of 15-hydroxyprostaglandin dehydrogenase in the NCBI gene bank, the sequence is as shown in SEQ ID No.1, specifically as follows:
[0048] tgcacgtgaacggcaaagtggcgctggtgaccggcgcggctcagggcataggcagagcctttgcagaggcgctgctgcttaagggcgccaaggtagcgctggtggattggaatcttgaagcaggtgtacagtgtaaagctgccctggatgagcagtttgaacctcagaagactctgttcatccagtgcgatgtggctgaccagcaacaactgagagacacttttagaaaagttgtagaccactttggaagactggacattttggtcaataatgctggagtgaataatgagaaaaactgggaaaaaactctgcaaattaatttggtttctgttatcagtggaacctatcttggtttggattacatgagtaagcaaaatggaggtgaaggcggcatcattatcaatatgtcatctttagcaggactcatgcccgttgcacagcagccggtttattgtgcttcaaagcatggcatagttggattcacacgctcagcagcgttggctgctaatcttatgaacagtggtgtgagactgaatgccatttgtccaggctttgttaacacagccatccttgaatcaattgaaaaagaagaaaacatgggacaatatatagaa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More