Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Compositions useful in treatment of spinal muscular atrophy

A technology of identity and protein, applied in drug combination, introduction of foreign genetic material using carrier, application, etc., can solve problems such as small improvement

Pending Publication Date: 2020-01-31
THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF53 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, lower doses showed little improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions useful in treatment of spinal muscular atrophy
  • Compositions useful in treatment of spinal muscular atrophy
  • Compositions useful in treatment of spinal muscular atrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0226] Example 1-New clade FAAV-AAVhu68

[0227] A QIAamp column (Qiagen) was used to extract tissue DNA from human tissue samples as a PCR template according to the manufacturer's recommendation (with the following modifications). As described by Gao et al. [Proc Natl Acad Sci USA, 2002 Sep3, 99(18): 11854-11859 (Epub August 21, 2002)], because Q5 DNA polymerase ( Hot Start High-Fidelity2X Master Mix, NEB) has extraordinary high fidelity and strong efficiency. The Q5 DNA polymerase was selected to recover the full-length VP1 gene of potential AAV in the sample, and the primer set was modified as follows: Use primer prm504[GCTGCGTCAACTGGACCAATGAGAAC SEQ ID NO: 23] was used instead of AV1NS, and prm505 [CGCAGAGACCAAAGTTCAACTGAAACGA, SEQ ID NO: 24] was used instead of reverse primer AV 2CAS. The PCR conditions were modified as follows:

[0228] μL water9 prm5041.25 prm5051.25 template1 2XQ512.5

[0229] PCR program

[0230]

[0231] The ~3kb band from PCR was cut out from t...

Embodiment 2

[0234] Example 2-AAVhu68 vector

[0235] Generate and evaluate AAVhu68 and AAV9 vectors carrying multiple tags (such as GFP and LacZ). Each vector is produced in 293 cells using triple transfection technology, such as Gao et al. [Gao, Guang-Ping, et al. "Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy." Proceedings of the National Academy of Sciences 99.18(2002):11854-11859].

[0236] 1. The production of pAAVhu68 trans plasmid

[0237] The nucleic acid sequence encoding vpl capsid protein is provided in SEQ ID NO:7.

[0238] The pAAV2 / hu68 trans plasmid was prepared by loading the VP1 gene of hu68 into the pAAV2 / 9 backbone instead of the AAV9 VP1 gene to evaluate packaging efficiency, yield and transduction properties. The pAAV2 / 9 plasmid contains the AAV2 5'and 3'ITRs flanking the capsid gene, and is available from Penn Vector Core [University of Pennsylvania, Phila, PAUS, pennvectorcore.med.upenn.edu].

[0239] 2. Production of AAVhu68 vector

...

Embodiment 3

[0247] Example 3-AAV vector containing hSMN

[0248] AAVhu68.CB7.CI.hSMN1co.RBG consists of external components and internal DNA genome. The external vector component is serotype hu68, T=1 icosahedral capsid, which is composed of 60 copies of three AAV viral proteins VP1, VP2 and VP3 at a ratio of about 1:1:8-10. The capsid contains a single-stranded DNA genome composed of a human motor neuron survival 1 (hSMN1) transgene flanked by two AAV inverted terminal repeats (ITR). The enhancer, promoter, intron, hSMN1 coding sequence, and polyadenylation (polyadenylation) signal constitute the human SMN1 transgene. ITR is the genetic element responsible for genome replication and packaging during the vector production process, and is the only viral cis element required to produce rAAV. The expression of the hSMN1 coding sequence is driven by the CB7 promoter, which is a hybrid between the cytomegalovirus (CMV) immediate early enhancer (C4) and the chicken β-actin promoter. The transcr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
heightaaaaaaaaaa
Login to View More

Abstract

A rAAV vector is described herein which has an AAVhu68 capsid and at least one expression cassette in the capsid. The at least one expression cassette comprises nucleic acid sequences encoding a functional SMN protein and expression control sequences that direct expression of the SMN sequences in a host cell. Also provided are compositions containing this rAAVhu68.SMN vector and methods of using same for spinal muscular atrophy in a patient.

Description

Background technique [0001] Spinal muscular atrophy (SMA) is a neuromuscular disease caused by mutations in telomere SMN1, which encodes a commonly expressed protein involved in spliceosome biogenesis (survival of motor neuron, SMN). )) genes. SMA is an autosomal recessive genetic disease caused by the mutation or deletion of SMN1 gene. It has been shown that providing a functional SMN1 gene rescues this phenotype. See, for example, Tanguy et al., Systemic AAVrh10 provides higher transgene expression than AAV9 in the brain and the spinal cord of neonatal mice, Frontiers in Molecular Neuroscience, 8(36) (July 2015). [0002] The International SMA Consortium classification defines multiple severity levels of SMA phenotypes based on age of onset and milestones in motor development. The SMA0 name is used to reflect prenatal episodes and severe joint contractures, facial diplegia and respiratory failure. Type 1 (or I) SMA (Weidnich-Hoffman disease I disease) is the most severe post...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864
CPCC12N15/86A01K2227/105A01K2267/0318C12N2750/14143C12N2800/22C07K14/47A61P21/00A61P25/00A61K48/005A61K45/06C12N15/864C12N15/8645
Inventor J.M.威尔逊C.辛德勒N.卡茨王强
Owner THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com