Method for detecting schistosoma japonicum infection by using host exosome miRNA-142a-3p

A technology of schistosomiasis and exosomes, applied in the direction of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of lack of rapid, sensitive, specific and stable detection methods for Schistosoma japonicum, low sensitivity, Insufficient specificity and other issues, to achieve good clinical application value, high sensitivity, and reduce the effect of patient trauma

Inactive Publication Date: 2020-02-07
SUN YAT SEN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Immunological diagnosis is not a direct detection of pathogens, with low sensitivity and insufficient specificity
[00

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting schistosoma japonicum infection by using host exosome miRNA-142a-3p
  • Method for detecting schistosoma japonicum infection by using host exosome miRNA-142a-3p
  • Method for detecting schistosoma japonicum infection by using host exosome miRNA-142a-3p

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 A diagnostic kit for Schistosoma japonicum infection

[0051] 1. Composition

[0052] Amplification primers for serum exosome miR-142a-3p, internal reference gene U6 amplification primers and q-PCR reagents;

[0053] Among them, the upstream primer nucleotide of serum exosomal miR-142a-3p is shown in SEQ ID NO: 2 (CTGTAGTGTTTCCTACTTTATG), and the downstream primer is provided in the commercially available microRNA quantitative (qRT-PCR) (tailing method) kit Universal primers;

[0054] The nucleotide sequence of the internal reference gene U6 amplification primer is shown in SEQ ID NO: 3-4,

[0055] SEQ ID NO: 3: GGAACGATACAGAGAAGATTAGC,

[0056] SEQ ID NO: 4: TGGAACGCTTCACGAATTTGCG;

[0057] The reagents for q-PCR are Premix Ex Taq TM , ROX Dye (50×) and ddH 2 O.

[0058] 2. How to use

[0059] 1. Extract exosomes from serum samples to be tested

[0060] Use a commercially available serum exosome extraction kit.

[0061] 2. Extract total exosome RN...

Embodiment 2

[0082] Embodiment 2 detection sensitivity effect analysis

[0083] 1. Experimental method

[0084] The kit in Example 1 was used to detect serum exosomal miR-142a-3p from healthy people from schistosomiasis-endemic areas and schistosomiasis-infected groups.

[0085] 2. Experimental results

[0086] The expression of exosomal miR-142a-3p in schistosomiasis-infected people was higher than that in healthy people, which was more than 2 times higher.

Embodiment 3

[0087] Embodiment 3 mouse model experiment verification sensitivity

[0088] 1. Experimental method

[0089] The schistosomiasis-infected mouse model was routinely constructed, and the sera of mice in the uninfected control group and the infected group were collected, and exosomes were extracted. The kit of claim 2 is used to detect serum exosomal miR-142a-3p of mice in the uninfected control group and the infected group.

[0090] 2. Experimental results

[0091] The serum exosomal miR-142a-3p expression level of mice in the infected group was higher than that in the uninfected control group, which was more than 2 times higher.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for detecting schistosoma japonicum infection by using a host exosome miRNA-142a-3p. A nucleotide sequence of the serum exosome miR-142a-3p is as shown in SEQ ID NO 1,and the method for detecting the schistosoma japonicum infection is established based on primers with a nucleotide sequence as shown in SEQ ID NO 2. The method for detecting the schistosoma japonicuminfection by using the host exosome miRNA-142a-3p is rapid, sensitive, specific and stable to detect. According to the method, serum of patients is directly extracted so that the trauma of the patients is reduced, and the trauma is small; a q-PCR detection method is used, and the sensitivity is high; and the q-PCR detection method has high sensitivity. At present, a mature exosome extraction kitis provided, meanwhile, q-PCR detection is a commonly used technology in a laboratory and is relatively simple. Therefore, the method is worth popularizing and has a good clinical application value.

Description

technical field [0001] The invention relates to the technical field of molecular detection of parasites, and more specifically, to the detection of Schistosoma japonicum infection by using host exosome miRNA-142a-3p. Background technique [0002] Schistosomiasis is a zoonotic parasitic disease caused by schistosomiasis infection that seriously affects human health and social and economic development. The main pathogen causing schistosomiasis in my country is Schistosoma japonicum. Schistosomiasis is still one of the important public health problems in my country. [0003] Exosomes (exosomes) are secreted by living cells, with a diameter of 30-150 nm and a mass concentration of 1.13-1.21 g / ml, carrying abundant subcellular bilayer membranous secretory vesicles related to their functions and source cells. It not only contains DNA fragments, proteins and lipids related to cell origin, but also biologically active substances such as RNA and miRNA, and plays an important role in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6888C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/6888C12Q2600/166C12Q2600/178C12Q2531/113
Inventor 吴忠道孙希王立富高江梅余子龙
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap