Supercharge Your Innovation With Domain-Expert AI Agents!

Anti-human CA153 protein recombinant antibody

A technology of antibody and binding protein, applied in the field of immunity, can solve the problems of low activity and poor affinity, and achieve the effect of high affinity and strong activity of binding protein

Active Publication Date: 2020-02-21
DONGGUAN PENGZHI BIOTECH CO LTD
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to low activity and poor affinity, the existing CA153 antibodies cannot be well applied to the detection of CA153 protein. Therefore, there is a strong demand in this field for antibodies that can effectively and specifically bind and detect CA153

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-human CA153 protein recombinant antibody
  • Anti-human CA153 protein recombinant antibody
  • Anti-human CA153 protein recombinant antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0115] In this example, the restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company. MagExtractor-RNA extraction kit was purchased from TOYOBO Company. SMARTERTM RACE cDNA Amplification Kit was purchased from Takara Company. The pMD-18T vector was purchased from Takara Company. Plasmid extraction kit was purchased from Tiangen Company. Primer synthesis and gene sequencing were performed by Invitrogen.

[0116] 1.1. Primers

[0117] Amplify Heavy Chain and Light Chain 5'RACE Primers:

[0118] SMARTER II A Oligonucleotide:

[0119] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';

[0120] 5'-RACE CDS Primer (5'-CDS): 5'>(T) 25 VN<3'(N=A,C,G,orT; V=A,G,orC);

[0121] Universal Primer A Mix(UPM):

[0122] 5’>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT<3’

[0123] Nested Universal Primer A(NUP):

[0124] 5’>AAGCAGTGGTATCAACGCAGAGT<3’

[0125] mIg-kR: 5'>CCCGAATTCCTAACACTCATTCCTGTTGAAGCTCTTGAC<3'.

[0126] mIg-HR: 5'>TTTACCAGGAGAGTGGGAGAGGCTCTT...

Embodiment 2

[0143] Transient Transfection of Recombinant Antibody Expression Plasmids into CHO Cells and Identification of Antibody Activity in Expression Supernatant

[0144] The plasmid was diluted to 400ng / ml with ultrapure water, and the CHO cells were adjusted to 1.43×10 7 cells / ml in a centrifuge tube, mix 100ul plasmid with 700ul cells, transfer to electroporation cup, electroporation, transfer to 10ml CD CHO AGT medium, culture in 37 degree shaker (8% CO 2 , amplitude 150); sampling every day to detect cell viability, when the cell viability is lower than 50%, centrifugal cell culture supernatant, the antibody obtained (has sequence such as light chain and heavy chain shown in SEQ ID NO:11 and 12 ).

[0145] After analysis, the complementarity determining region (WT) of the heavy chain:

[0146] CDR-VH1 is G-A(X1)-T-F-T(X2)-N-Y-W

[0147] CDR-VH2 is E-I-R-V(X1)-K-S-N-Q(X2)-Y-A-S(X3)-H-Y-A-E-S-V;

[0148] CDR-VH3 is R-Q(X1)-I(X2)-T-T-L(X3)-Y-Y-A-M-D-Y;

[0149] Complementarity...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel isolated binding protein comprising a CA153 protein antigen binding structural domain, and researches in aspects of preparation, application and the like of the binding protein. The binding protein has high activity and high affinity with human CA153 protein, and can be widely applied to the field of CA153 protein detection.

Description

technical field [0001] The invention relates to the technical field of immunization, in particular to a recombinant antibody against human CA153 protein. Background technique [0002] Breast cancer (Breast Cancer) is one of the most common malignant tumors in women. About 1.2 million women in the world suffer from breast cancer every year, and about 500,000 die from breast cancer. In recent years, the incidence of breast cancer in my country has been increasing year by year, and its pathogenic characteristics are younger age of onset, asymptomatic in the early stage, relatively late disease stage when seeing a doctor, and shortened survival period due to metastasis, so early diagnosis, Early treatment is the key to improving the survival rate of patients. [0003] How to improve the early diagnosis rate of breast cancer is a common concern of scholars at home and abroad. When breast cancer-related serum markers are used alone for early diagnosis, the clinical use of these m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/30C12N15/13G01N33/68G01N33/574
CPCC07K16/3015G01N33/68G01N33/57415G01N33/57423G01N33/57449G01N33/57419
Inventor 崔鹏何志强孟媛游辉
Owner DONGGUAN PENGZHI BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com