Construction method and application of AAV vector for specific expression of CRE in mouse hippocampus CA2 region
A construction method, mouse technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Cloning of the Map3k15 promoter fragment
[0035] (1) DNA extracted from mouse brain (Qiagen DNeasy Blood and Tissue Kit, Catalog No.69504) was used as a template to amplify fragments of different lengths at the 5'-end of Map3k15 (Takara PrimerSTAR HS DNA polymerase, Catalog No. R010A).
[0036] A 3639bp fragment at the 5'-end of Map3k15 was amplified, which also included a part of Exon1 369bp downstream of the start codon. Use primer pairs:
[0037]Map3kpromo-F2:aggttggctgcaaactcact;
[0038] Map3kpromo-R: atcgtagaaggcatcgagcac;
[0039] Simultaneously amplify the 2293bp Map3k15 5'-terminal promoter fragment in the same way, using the primer pair:
[0040] Map3kpromo-F: gctggaactagggaaggatttc;
[0041] Map3kpromo-R: atcgtagaaggcatcgagcac;
[0042] At the same time, the 499bp Map3k15 5'-terminal promoter fragment was amplified in the same way, and the primer pair was used:
[0043] Map3kpromo-F3:ggaggaagtcaggggagggaggaaa;
[0044] Map3kpromo-R3: gcgggg...
Embodiment 2
[0047] Embodiment 2: Determination of Map3k15 activation efficiency
[0048] The three Map3k15 5'-end amplified fragments were subcloned into pGL4.0 plasmid respectively, using a non-ligase-dependent multi-fragment one-step cloning technique (Vazyme, ClonExpress MultiS One Step Cloning Kit, C113-02) and the following primer pairs :
[0049] 3639bp fragment
[0050] Map3k15-F2-Pgl4.1-F2: cctgagctcgctagcctcgagAGGTTGGCTGCAAACTCACTATG
[0051] Map3k15-R-Pgl4.1-R: cagtaccggattgccaagcttATCGTAGAAGGCATCGAGCACG
[0052] 2219bp fragment
[0053] Map3k15-F-Pgl4.1-F: cctgagctcgctagcctcgagGCTGGAACTAGGGAAGGATTTC
[0054] Map3k15-R-Pgl4.1-R: cagtaccggattgccaagcttATCGTAGAAGGCATCGAGCACG
[0055] 499bp fragment
[0056] Map3k15-F3-Pgl4.1-F: cctgagctcgctagcctcgagGGAGGAAGTCAGGGAGGGAGGAAA
[0057] Map3k15-R3-Pgl4.1-R: cagtaccggattgccaagcttGCGGGGCTGGCGGCTTCGAA
[0058] The multiple cloning sites of pGL4.0 are XhoI (5'-end) and HindIII (3'-end).
[0059] (2) Plasmid-transfected cells:
[0...
Embodiment 3
[0077] Embodiment 3: Construction of rAAV-Map3k15-Cre plasmid vector
[0078] Using the rAAV-EF1α-NLS-Cre-WPRE-pA (Wuhan Privy Brain Science and Technology Co., Ltd., #143) plasmid as the vector backbone, the 499bp fragment of Map3k15 was cloned into MluI and SalI two enzyme cutting sites. Use primer pairs:
[0079] 143-map-F3-F:gttcctgcggccgcacgcgtGGAGGAAGTCAGGGAGGGAGG
[0080] 143-map-F3-R:ttcttgggggccatgtcgacGCGGGGCTGGCGGCTTCG
[0081] get as figure 2 The indicated plasmid vector was sent to Wuhan Privy Science and Technology Co., Ltd. for virus packaging.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com