Coating for aldehyde remediation and method of making
A technology of coating and formaldehyde, which is applied in the field of formaldehyde removal, can solve problems such as none
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0069] Example 1: Preparation of formate oxidase (FOX)
[0070] Cloning, expression and purification of his-tagged FOX The following synthetic cDNA sequence of FOX from Aspergillus oryzae RIB40 was purchased from (New York, Grand Island, Life Technologies Inc.).
[0071]ATGGCAACCGATGGTAGCCATTTTGATTTTGTTATTGTTGGTGGTGGCACCGCAGGTAATACCGTTGCAGGTCGTCTGGCAGAAAATCCGAATGTTACCGTTCTGATTGTTGAAGCCGGTATTGGTAATCCGGAAGATATCCCGGAAATTACCACCCCGAGCAGCGCAATGGATCTGCGTAATAGCAAATATGATTGGGCCTATAAAACCACCATGGTTCGTCGTGATGATTATGAACGTATTGAAAAACCGAATACCCGTGGTAAAACCCTGGGTGGTAGCAGCAGCCTGAACTATTTTACCTGGGTTCCGGGTCATAAAGCAACCTTTGATCAGTGGGAAGAATTTGGTGGTAAAGAATGGACCTGGGATCCGCTGGTTCCGTATCTGCGCAAAAGCGCAACCTATCATGATGATCCGCGTCTGTATAGTCCGGAACTGGAAAAAATTGGTGGCGGTGGTCCGATTCCGATTAGCCATGCAGAACTGATTGATGAAATGGCACCGTTTCGTGAAAATCTGACCAAAGCATGGAAAAGCATGGGTCAGCCGCTGATTGAAAACATTTATGATGGTGAAATGGATGGCCTGACCCATTGTTGTGATACCATTTATCGTGGTCAGCGTAGCGGTAGCTTTCTGTTTGTTAAAAACAAACCGAACATTACCATTGTGCCGGAAGTTCATAGCAAACGCCTGATTATTAACGAAGCAGATCGT...
example 2
[0078] Example 2: Preparation of alcohol / aldehyde oxidase (AOX)
[0079] A growing wild-type GS113 Pichia strain overproduces AOX in peroxisomes under methanol induction. Cell pellets containing AOX were collected and stored at -80 °C. Cells were disrupted using a bead mill and glass beads to release AOX, and soluble AOX was purified using fractionated ammonium sulfate precipitation followed by rebuffering and PEG 4000 precipitation to concentrate AOX. AOX can be re-dissolved after PEG 4000 treatment, while other proteins cannot. To further enhance the ability of AOX, 45% sucrose or 45% trehalose can be used as excipients to stabilize AOX. Different formulations have been shown to enhance AOX stability. The enzyme may be used in its liquid form, or lyophilized and subsequently redissolved or applied in its dry form. Subsequently, any of these formulations can be used to eliminate alcohols or aldehydes, particularly formaldehyde, using the assays described herein.
example 3
[0080] Example 3: Fermentation, purification and cloning of new AOX variants from Pichia pastoris (Komagataella pastoris)
[0081]6 L fermentations were performed with Pichia strain GS113 using the classic Pichia protocol as previously described. The strain was fermented and produced AOX using a semi-synthetic medium. The medium consisted of basal salt medium supplemented with glycerol, phosphoric acid and traces of salt, see Table 1. The broth was inoculated with 200 ml of overnight culture and after 48 hours, a glycerol feed of 50% glycerol stock solution was applied at 18 ml / hr / L for 8 hours until Pichia reached mid-to-late logarithmic phase and high consumption was stopped. oxygen. Throughout the fermentation, the pH was adjusted to 4.5 using a concentrated ammonia feed (28% NH3). by pO 2 Ratio adjusted feed, AOX induction was initiated by methanol feed in an incrementally controlled manner (feed increased from 1 to 3 ml / h / L) and continued for a further 48 hours. Cell...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
| pore size | aaaaa | aaaaa |
| particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More