Application of Peptostreptococcus asaccharoly glutamate dehydrogenase (GdhA) in increasing yield of Bacillus licheniformis poly-gamma-glutamic acid

A technology of Bacillus licheniformis and glutamate dehydrogenase, which is applied in the fields of enzyme engineering and genetic engineering, can solve problems such as the comparison and unanalyzed research of glutamate dehydrogenase without research on Bacillus glutamate dehydrogenase , to achieve the effect of increasing the synthesis level of poly-γ-glutamic acid and improving the effect of poly-γ-glutamic acid

Active Publication Date: 2020-04-03
HUBEI UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no research on the analysis and research of glutamate dehydrogenase that affects the high production of poly-γ-glutamic acid
Peptostreptococcus is a normal flora in the human oral cavity, upper respiratory tract and intestinal tract. No research has yet shown that it has the ability to synthesize poly-γ-glutamic acid, and there is no research on its glutamate dehydrogenase and its interaction with Bacillus glutamate dehydrogenase for comparison

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Peptostreptococcus asaccharoly glutamate dehydrogenase (GdhA) in increasing yield of Bacillus licheniformis poly-gamma-glutamic acid
  • Application of Peptostreptococcus asaccharoly glutamate dehydrogenase (GdhA) in increasing yield of Bacillus licheniformis poly-gamma-glutamic acid
  • Application of Peptostreptococcus asaccharoly glutamate dehydrogenase (GdhA) in increasing yield of Bacillus licheniformis poly-gamma-glutamic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Construction of Peptostreptococcus glutamate dehydrogenase replacement strain Bacillus licheniformis WX-gdhA:

[0025] 1. According to the genome DNA sequence of Peptostreptococcus asaccharolyticus DSM 20463, the gdhA gene (gene amplification primers are T2-F2 and T2-R2) (shown in SEQ ID NO.2) is synthesized by gene; WX-02 genomic DNA was used as a template, and the upstream homology arm of the glutamate dehydrogenase gene rocG of Bacillus licheniformis itself (primers T2-F1 and T2-R1) and the downstream homology arm of the gene rocG (primers T2-R1) were amplified by PCR. for T2-F3 and T2-R3);

[0026] T2-F1:GCTCTAAGAGCGGCTGATGAAGGT

[0027] T2-R1:ACGGATTAAGTGTATCTGTCATTAACAGGCACGCCAAAAG

[0028] T2-F2: CTTTTGGCGTGCCTGTTAATGACAGATACACTTAATCCGT

[0029] T2-R2: CGCTAAGACTTCCAGGTGATTAATACCATCCTCTAATTTC

[0030] T2-F3:GAAATTAAGAGGATGGTATTAATCACCTGGAAGTCTTAGCG

[0031] T2-R3: CGAGCT ATCAAAAACAGAAGGGGGAGGA

[0032] 2. Connect the upstream homology arm of the gene rocG, ...

Embodiment 2

[0043] Application of Bacillus licheniformis WX-gdhA in improving the fermentation yield of poly-γ-glutamic acid:

[0044] Fermentation Product Yield Analysis

[0045] The recombinant bacterial strain obtained in Example 1 was inoculated into LB medium, cultivated at 37°C for 14 hours; 50 mL of poly-γ-glutamic acid fermentation medium (Table 1) was loaded into a 500 mL Erlenmeyer flask, and then the seed-cultured bacteria The solution was inoculated into the fermentation medium with an inoculum amount of 3% (volume percentage). The culture conditions are 230 r / min, 37° C., and 36 hours of fermentation period.

[0046] In this example, for different fermentation medium formulations, the influence of Bacillus licheniformis WX-gdhA on the synthesis level of poly-γ-glutamic acid was investigated (while also inoculating Bacillus licheniformis WX with the same inoculum amount in these 24 kinds of media) -02 as a contrast), 24 groups of culture medium formulations are specifically ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering and enzyme engineering, and discloses application of Peptostreptococcus asaccharoly glutamate dehydrogenase (GdhA) in increasing the yield of Bacillus licheniformis poly-gamma-glutamic acid. According to the invention, with a homologous recombination mode, glutamate dehydrogenase (GdhA) derived from Peptostreptococcus asaccharoly replaces glutamate dehydrogenase of Bacillus licheniformis (WX-02), the synthesis level of the Bacillus licheniformis poly-gamma-glutamic acid is remarkably improved, and the yield of the obtained strainpoly-gamma-glutamic acid is at least increased by 20% or above compared with that of a control strain. The invention provides a new strategy for efficient production of poly gamma-glutamic acid.

Description

technical field [0001] The invention belongs to the technical fields of enzyme engineering and genetic engineering, and specifically relates to the application of peptostreptococcus glutamic acid dehydrogenase GdhA in increasing the yield of poly-γ-glutamic acid of bacillus licheniformis. Background technique [0002] Poly-γ-glutamic acid is an anionic polypeptide composed of D / L-type glutamic acid residues linked by amide bonds between α-amino and γ-carboxylic acid groups. Because of its biological structure characteristics, it has many excellent properties. As a water-soluble, biodegradable, biocompatible, edible, non-toxic biodegradable material, poly-γ-glutamic acid can be widely used in food, agriculture, medicine, cosmetics, environmental protection and other fields. Therefore, poly-γ-glutamic acid has broad application prospects. [0003] At present, the commercial production of poly-γ-glutamic acid mainly relies on microbial fermentation, but due to the need to add...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P13/02C12N9/06C12N1/21C12R1/10
CPCC12P13/02C12N9/0016C12Y104/01002C12Y104/01003C12Y104/01004C12P21/02C12N1/38C12N1/205C12R2001/10
Inventor陈守文杨帆蔡冬波陈耀中张清马昕陈建刚
OwnerHUBEI UNIV