Application of human TTLL4 gene and related products
A gene and application technology, applied in the application of human TTLL4 gene and related products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0109] Example 1 Preparation of RNAi lentivirus against human TTLL4 gene
[0110] 1. Screening for effective siRNA targets against the human TTLL4 gene
[0111] Retrieve TTLL4 (NM_014640) gene information from Genbank; design effective siRNA targets for TTLL4 gene. Table 1-1 lists the screened effective siRNA target sequences against TTLL4 gene.
[0112] Table 1-1 is targeted at the siRNA target sequence of human TTLL4 gene
[0113] SEQ ID NO TargetSeq(5'-3') 1 CCTCATTCATCAGTCTCTTTT
[0114] 2. Preparation of lentiviral vector
[0115] Aim at the siRNA target (take SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 1-2) with Age I and EcoR I restriction sites at both ends; Dicer acts on the pGCSIL-GFP vector (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd.) to linearize it, and agarose gel electrophoresis identifies the digested fragment.
[0116] Table 1-2 Double-stranded DNA Oligo with sticky ends co...
Embodiment 2
[0134] Example 2 Real-time fluorescent quantitative RT-PCR method to detect gene silencing efficiency
[0135] A549 human lung cancer cells and NCI-H1299 human non-small cell lung cancer cells in the logarithmic growth phase were respectively trypsinized to make cell suspensions (the number of cells was about 5×10 4 / ml) were inoculated in 6-well plates, and cultured until the cell confluency reached about 30%. According to the multiplicity of infection value (A549:10, NCI-H1299:5, this multiplicity of infection is used in the following contents of the manual), add an appropriate amount of the lentivirus prepared in Example 1, and replace the medium after 24 hours of cultivation. After reaching 5 days, the cells were harvested. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 2-1 for the reverse transcription reaction system, ...
Embodiment 3
[0143] Example 3 Celigo assay detects the proliferation ability of tumor cells infected with TTLL4-shRNA lentivirus
[0144] The A549 human lung cancer cells and NCI-H1299 non-small cell lung cancer cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in 6-well plates, and cultured until the cell confluency reached about 30%. According to the multiplicity of infection, an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 3 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), A549 was inoculated in a 96-well plate at a cell density of about 2000 cells / well, and NCI-H1299 800 cells / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



