Unlock instant, AI-driven research and patent intelligence for your innovation.

Retrotransposon Ra-RARE-1 having autonomous transposition activity and applications thereof

A technology of retrotransposon and ra-rare-1, applied in application, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems that cannot fully meet the needs of scientific research and specific applications

Active Publication Date: 2020-05-01
SUN YAT SEN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, with the increasing demand for gene editing technology diversification, due to the particularity of the sequence of the existing transposons, it can no longer fully meet the needs of scientific research and specific applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Retrotransposon Ra-RARE-1 having autonomous transposition activity and applications thereof
  • Retrotransposon Ra-RARE-1 having autonomous transposition activity and applications thereof
  • Retrotransposon Ra-RARE-1 having autonomous transposition activity and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Extraction of Mangrove DNA and Acquisition of Retrotransposon Ra-RARE-1 ​​Full-length Sequence

[0031] 1. Experimental method

[0032] Adopt the improved CTAB method (Doyle and Doyle, 1990) to extract the total DNA of mangrove leaves, utilize the kit of TaKaRa company HS DNA Polymerase, amplified the full-length sequence of Ra-RARE-1 ​​according to the reaction system of its instruction manual, and the amplification primer pair was Ra-full-F / Ra-full-R (sequence shown in SEQ ID NO: 2~3 );

[0033] Primer Ra-full-F (SEQ ID NO: 2): 5'-ATAGGTACCTCAATTACCCCCTTAACATGGTAGTCAGG-3';

[0034] Primer Ra-full-R (SEQ ID NO: 3): 5'-CATGAGCTCACTTGTTGCCACATAGTTCCTTCTTTTG-3';

[0035] The recognition sequence of restriction endonuclease KpnI (5'-GGTACC-3') or SacI (5'-GAGCTC-3') was added to the 5' end of primer Ra-full-F / Ra-full-R.

[0036] The amplification program was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, renaturation at 60°C for 30 sec...

Embodiment 2

[0040] Example 2 Construction of the recombinant expression vector pYES2-RARE-1-mHIS3AI containing the expression cassette of the screening marker gene HIS3AI

[0041] 1) Acquisition of pMD19T-AI plasmid containing AI sequence

[0042] The intron (AI) sequence was synthesized by Life Technologies to obtain the pMD19T-AI plasmid containing the AI ​​sequence; the AI ​​sequence is shown in SEQ ID NO: 4;

[0043] AI sequence (SEQ ID NO: 4): 5'-AAGCTTACGTATGTTATATGGACTA AAGGAGGCTTTTCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTTTTACTAACAAATGGTATTATTTATAACAGCTGAATTC-3'.

[0044] (2) Contains EZ-T TM -Acquisition of positive clones of the HIS3 plasmid

[0045] The HIS3 gene is derived from the yeast (Saccharomyces cerevisiae) genome. After the yeast genomic DNA was extracted using the Yeast GenomicDNA Kit, HIS-F / HIS-R (sequence shown in SEQ ID NO: 6-7) was amplified with primers, and then applied The same method as in Example 1 was recovered, connected, transformed and sequenced to ...

Embodiment 3

[0054] Example 3 Analysis of transposition activity of retrotransposon Ra-RARE-1 ​​in yeast

[0055] 1. Experimental method

[0056] Saccharomyces is a eukaryotic organism. The HIS3 gene in yeast is involved in the biosynthesis of histidine. We put a forward intron AI in the reverse HIS3 gene, because the transcription direction of AI and HIS3 gene is opposite; Therefore, AI cannot be cut correctly, so the HIS protein cannot be expressed.

[0057] Schematic diagram of retrotransposon Ra-RARE-1 ​​transposition experiment figure 1 As shown in the (B) figure, we put the above-mentioned reverse HIS3 gene containing forward intron AI in the forward retrotransposon Ra-RARE-1, located after the retrotransposon ORF , before the 3'LTR; if the retrotransposon has transposition activity, since the AI ​​is in the same transcription direction as the retrotransposon, the AI ​​is cut correctly, and when the modified transcript is reverse transcribed into DNA and integrated When the HIS3 g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a retrotransposon Ra-RARE-1 having autonomous transposition activity and applications thereof. The retrotransposon Ra-RARE-1 having autonomous transposition activity is provided for the first time and derived from rhizophora apiculata genomes, and the length of the sequence of the retrotransposon Ra-RARE-1 is 6998 bp. The retrotransposon has autonomous transcription and transposition capabilities, can perform autonomous proliferation and is low in activity; the harmful effects of conventional retrotransposon on the genomes due to massive proliferation can be greatly reduced by genetically modifying the retrotransposon into other eukaryotic genomes; due to the special transposition mechanism of the retrotransposon, the newly generated copies can stably exist in the insertion sites of the genomes, so that the specific traits generated during gene function analysis and molecular breeding can be stably maintained; and thus, the retrotransposon has wide application prospects in gene function analysis and molecular breeding.

Description

technical field [0001] The invention belongs to the field of biotechnology. More specifically, it relates to a retrotransposon Ra-RARE-1 ​​with autonomous transposition activity and its application. Background technique [0002] Transposon (transposon) is a DNA sequence that can move in the genome, and it has been found that it exists widely in the genome of animals and plants. The discovery of transposons is mostly due to their insertion into genes or near genes, resulting in changes in gene expression, resulting in certain phenotypic differences; for example, the earliest discovered Ac / Ds transposons were due to their insertion into pigment-forming genes Interruption causes three phenotypes of purple, yellow and purple spots in corn kernels; in addition, there are Pelement transposons in Drosophila, and mPing transposons in rice, etc., these transposons are due to their insertion Mutations were not discovered until after they resulted in the phenotype. The transposition...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/81A01H5/00A01H6/20C12N15/11
CPCC12N15/8222C12N15/81Y02A40/81
Inventor 唐恬王玉帅张添元
Owner SUN YAT SEN UNIV