Preparation and application of anti-perfluorooctane sulfonate potassium aptamer
A technology of potassium perfluorooctane sulfonate and nucleic acid aptamer, which is applied in the direction of biochemical equipment and methods, instruments, analytical materials, etc., and can solve the problems of expensive instruments and complicated operations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1) Design a random single-stranded library and complement it with downstream primers:
[0038] 5'-GCGCATACGAGCTTGTTCAATA (SEQ ID NO. 05)
[0039] -N40-TGATAGTAAGTGCAATCTAGCC (SEQ ID NO.06)-3' and biotin-modified downstream primer Biotin-PR: Biotin-C6-GGCTAGATTGCACTTACTATCA-3' (SEQ ID NO.07), molar ratio 1:1~1:2 , optimized to a ratio of 1:1.5 in a 200 μL PCR tube, add an appropriate amount of binding buffer (5×binding buffer containing 125mM Tris-HCl, 500mM NaCl, 125mMKCl, 50mM MgCl) 2 , 5% DMSO, pH 7.5) diluted into 1 × bindingbuffer in a PCR tube to 200 μL and mixed. Then put it in the PCR machine: 95°C for 10min, 4°C for 10min, and slowly return to room temperature for annealing;
[0040] 2) Take 10 μL Streptavidin Magnetic Bead Suspension (Thermo Fisher, USA) into a 1.5 mL centrifuge tube, add 200 μL 1×binding buffer to wash, and let stand on a magnetic stand for 1 min. When there is no magnetic bead suspension in the supernatant, Remove the supernatant and repea...
Embodiment 2
[0056] 1) Pretreatment of nitrocellulose membrane: Use scissors to cut several pieces of nitrocellulose membrane (only one sample) with a size of about 5mm × 5mm, put them on clean PE gloves marked in advance, and use pencils on the membrane. The upper right corner is marked as the position of the tweezers to prevent large-scale contamination of the membrane, and the 1mL syringe needle is used to locate the center of the membrane;
[0057] 2) Target immobilization: Take 2.5 μL of sample (experimental group: target solution; primer control group: target solution; bindingbuffer control group: binding buffer) and spot it in the center of the area marked by the syringe, and then add additional spotting after air-drying, and spotting for the second time After placing at room temperature for 1.5h;
[0058] 3) Washing the membrane: Place the target-immobilized nitrocellulose membrane in a 24-well plate (one membrane per well), add 1 mL of washing buffer (binding buffer containing 0.1...
Embodiment 3
[0073] High-throughput sequencing and result analysis:
[0074] 1) In order to avoid high-throughput sequencing errors caused by contamination, PCR amplification and electrophoresis were performed on the samples before sequencing ( Figure 5 );
[0075] 2) The amplified samples were subjected to high-throughput sequencing (llumina, MiSeq2x300bp.), and analyzed from three aspects: sequence homology, secondary structure diversity and complexity, and three-dimensional structural molecular docking. The sequences obtained from high-throughput sequencing 4 possible candidate sequences were selected from
[0076] PS1:
[0077] GCGCATACGAGCTTGTTCAATATGAGGCTTGTCGAATAACGTGTCTAATCGAGTCCCCGCCGTTGATAGTAAGTGCAATCTAGCC( Image 6 , SEQ ID NO.01)
[0078] PS36:
[0079] GCGCATACGAGCTTGTTCAATAATCGTGCTGTGCGCATACGAGCTTGTTCAATAGTGGTTGATAGTAAGTGCAATCTAGCC( Figure 7 , SEQ ID NO.02)
[0080] PS39:
[0081] GCGCATACGAGCTTGTTCAATATGAGGCTCGTCGAATAACGTGTCTAATCGAGTCCCCGCCGTTGATAGTAAGTGCAATCTAGCC(...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More