Primer composition, kit and method for detecting novel coronavirus

A primer composition and coronavirus technology, applied in the field of molecular biology, can solve the problems of complex products, not easy simultaneous analysis of multiple sequences, and complex applications.

Active Publication Date: 2020-06-02
湖南融健生物科技有限公司
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The LAMP product is complex, and it is difficult to further analyze the product related to sequence characteristics, resulting in complex subsequent applications, and it is not easy to further perform simultaneous analysis of multiple sequences
RCA relies on circular templates, but the vast majority of genomic DNA is linear molecules, and the cost of synthesizing rolling circle amplification padlock probes is high, and there are signal background problems
SDA needs to go through multiple stages such as the preparation of DNA single-stranded templates, the generation of target DNA fragments containing restriction sites at both the 5' end and the 3' end, and strand displacement reactions, and requires modified dNTPs as substrates, and target sequence preparation complex

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition, kit and method for detecting novel coronavirus
  • Primer composition, kit and method for detecting novel coronavirus
  • Primer composition, kit and method for detecting novel coronavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Amplification and detection of N gene and ORF1ab gene of 2019-nCoV The plasmid DNA containing N gene and ORF1ab gene of 2019-nCoV was used as detection target for screening dominant primers.

[0064]Wherein, the conserved sequence of the novel coronavirus N gene is shown in SEQ ID NO:25, and the conserved sequence of the novel coronavirus ORF1ab gene is shown in SEQ ID NO:26.

[0065] SEQ ID NO: 25

[0066] ATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC

[0067] SEQ ID NO: 26

[0068] TGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTA...

Embodiment 2

[0085] The reaction efficiency verification of embodiment 2 different primers

[0086] Preparation of an isothermal amplification reaction mixture containing Mg 2+ The concentration is 8mM; K + The concentration is 6mM; NH 4 + The concentration is 10mM; H +The concentration is 20mM; Cl - The concentration is 6mM; SO 4 2- The concentration of Tris-HCl is 10mM; the concentration of Tris-HCl is 20mM; the concentration of Triton X-100 is 0.01g / mL; the concentration of dNTP is 1.4mM; the concentration of thymine DNA glycosylase is 50U / mL; The concentration is 320U / mL; the concentration of MLV reverse transcriptase is 150U / mL; the primers shown in P1 in Table 1 are 0.2 μM, the primers shown in P2 are 0.8 μM, the primers shown in P3 are 0.2 μM, and the primers shown in P4 0.8 μM, and SYBRGreen I is a dye for real-time fluorescence analysis. Using the 3 sets of primers obtained after design, screening and comparison, use the N gene and ORF1ab gene plasmid DNA at a concentratio...

Embodiment 3

[0087] Example 3 Reaction Sensitivity Verification

[0088] The amplification detection mixture was prepared as described in Example 2, wherein the second set of N gene primers was used to perform amplification and real-time fluorescence detection of the real-time fluorescence curves of different concentrations of N gene plasmid DNA at 63°C and 90 min, and the concentrations were sequentially It is 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, 0 aM. Use a real-time fluorescent quantitative PCR instrument for detection, and read the fluorescence value every 30s. For the real-time fluorescence curve of the specific results, please refer to the attached Figure 4 . The real-time fluorescence curve shows that the concentration of N gene plasmid DNA can be detected as low as 10aM in this example, indicating that the detection method of the present invention has high sensitivity and extremely low detection limit.

[0089] The amplification detection mixture was prepared as described i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer composition, kit and method for detecting the novel coronavirus. The primer composition includes a first primer pair and a second primer pair which are used for detecting the N gene of the novel coronavirus, and also includes a third primer pair and a fourth primer pair which are used for detecting the ORFlab gene of the novel coronavirus. The method comprises the steps: using the primer composition, adopting the genomic DNA of a to-be-tested sample as a template, performing a constant-temperature amplification reaction under the action of thymine DNA glycosylase, MLV reverse transcriptase and Bst DNA polymerase, and performing quantitative analysis on the test results under the action of fluorescent dye so as to detect the novel coronavirus with high specificity and high sensitivity. The four primers are used, bases of the primers are specially modified, and the thymine DNA glycosylase and Bst DNA polymerase are added to the reaction, so that exponential amplification of target sequences of the N gene and the ORFlab gene are realized under the condition of constant temperature, and the sensitivity and specificity of detection are improved greatly.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to a primer composition for detecting a novel coronavirus, and also relates to a kit and a method for using the primer composition for detecting a novel coronavirus. Background technique [0002] Coronaviruses are classified in the family Cirinaviridae of the order Nidovirales. The genome of the coronavirus is a complete single-stranded positive-strand RNA, about 30Kb long, which is the longest RNA nucleic acid chain among RNA viruses. Due to the large and complex genome of the coronavirus, its transcription process is relatively complicated. The genomes of various coronaviruses are different, and different mutations can occur in their non-coding regions to change the regulatory functions. The coding region can encode different functional proteins, coupled with the lack of correction function of RNA virus replicase, the probability of virus recombination and mutation during the repli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844Y02A50/30
Inventor蒋健晖王海波唐丽娟
Owner湖南融健生物科技有限公司