Primer composition, kit and method for detecting novel coronavirus
A primer composition and coronavirus technology, applied in the field of molecular biology, can solve the problems of complex products, not easy simultaneous analysis of multiple sequences, and complex applications.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1 Amplification and detection of N gene and ORF1ab gene of 2019-nCoV The plasmid DNA containing N gene and ORF1ab gene of 2019-nCoV was used as detection target for screening dominant primers.
[0064]Wherein, the conserved sequence of the novel coronavirus N gene is shown in SEQ ID NO:25, and the conserved sequence of the novel coronavirus ORF1ab gene is shown in SEQ ID NO:26.
[0065] SEQ ID NO: 25
[0066] ATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC
[0067] SEQ ID NO: 26
[0068] TGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTA...
Embodiment 2
[0085] The reaction efficiency verification of embodiment 2 different primers
[0086] Preparation of an isothermal amplification reaction mixture containing Mg 2+ The concentration is 8mM; K + The concentration is 6mM; NH 4 + The concentration is 10mM; H +The concentration is 20mM; Cl - The concentration is 6mM; SO 4 2- The concentration of Tris-HCl is 10mM; the concentration of Tris-HCl is 20mM; the concentration of Triton X-100 is 0.01g / mL; the concentration of dNTP is 1.4mM; the concentration of thymine DNA glycosylase is 50U / mL; The concentration is 320U / mL; the concentration of MLV reverse transcriptase is 150U / mL; the primers shown in P1 in Table 1 are 0.2 μM, the primers shown in P2 are 0.8 μM, the primers shown in P3 are 0.2 μM, and the primers shown in P4 0.8 μM, and SYBRGreen I is a dye for real-time fluorescence analysis. Using the 3 sets of primers obtained after design, screening and comparison, use the N gene and ORF1ab gene plasmid DNA at a concentratio...
Embodiment 3
[0087] Example 3 Reaction Sensitivity Verification
[0088] The amplification detection mixture was prepared as described in Example 2, wherein the second set of N gene primers was used to perform amplification and real-time fluorescence detection of the real-time fluorescence curves of different concentrations of N gene plasmid DNA at 63°C and 90 min, and the concentrations were sequentially It is 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, 0 aM. Use a real-time fluorescent quantitative PCR instrument for detection, and read the fluorescence value every 30s. For the real-time fluorescence curve of the specific results, please refer to the attached Figure 4 . The real-time fluorescence curve shows that the concentration of N gene plasmid DNA can be detected as low as 10aM in this example, indicating that the detection method of the present invention has high sensitivity and extremely low detection limit.
[0089] The amplification detection mixture was prepared as described i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap