An isolated lettuce lskn1 gene and its application in controlling lettuce heading traits
A gene and technology of head lettuce, applied in the field of plant engineering, can solve problems that have not been reported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Acquisition of lettuce heading gene LsKN1:
[0025] 1. Genetic Analysis of Lettuce Heading Phenotype
[0026] In order to analyze the genetic law of lettuce heading traits, the present invention adopts heading lettuce (phenotype is heading) and romaine lettuce (phenotype is non-heading) to obtain F 1 , further selfing, get F 2 generation groups. to F 2 On behalf of the individuals, the ball phenotype was evaluated, recorded and statistically analyzed, and it was found that F 2 The heading phenotype in the population was a quantitative heritable trait with continuous distribution, implying that the heading phenotype of lettuce was a complex trait controlled by multiple genes.
[0027] 2. Map-based cloning of the LsKN1 gene
[0028] In order to clone the key genes controlling the heading traits of lettuce in the above populations, the analysis method of BSR-seq was adopted in this study. from F 2 In the population, 20 ball-bearing individual plants and 20 non-head-...
Embodiment 2
[0030] Application of Heading Gene LsKN1 in Lettuce Heading
[0031] The full-length sequence of the LsKN1 gene was amplified from the bulbous parent, and the primers were: LsKN1com F: GACCTGCAGGCATGCaagcttTGTCTGTTTCTTTCTACCCAA; LsKN1com R: GCTGGTCACCTGTAATTCAcacgtgGTGTTCTTTATTTTCTACTA, and the amplified target fragment included the sequence shown in SEQ ID NO.1. It was inserted into the pCAMBIA1301 plant expression vector (the vector was linearized by HindIII / PmlI), and transformed into non-heading lettuce (lskn1 / lskn1) under the mediation of Agrobacterium, and a total of 4 transgenic plants were obtained, and each strain All showed the ball phenotype ( figure 1 Middle a). T for one of the transgenic lines 1 According to the analysis of generation head phenotype and genotype (primers for genotype identification: ValLsKN1COM F: CGGTTGTTTATTGGTGTATT; ValLsKN1COM R: CGAGGGTAATGAGGATGAGAC), the individual plants with transgene insertion all showed head head phenotype, while the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

