Unlock instant, AI-driven research and patent intelligence for your innovation.

An isolated lettuce lskn1 gene and its application in controlling lettuce heading traits

A gene and technology of head lettuce, applied in the field of plant engineering, can solve problems that have not been reported

Inactive Publication Date: 2020-12-25
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, neither the inheritance of heading traits in lettuce nor the genes controlling heading traits have been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An isolated lettuce lskn1 gene and its application in controlling lettuce heading traits
  • An isolated lettuce lskn1 gene and its application in controlling lettuce heading traits

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Acquisition of lettuce heading gene LsKN1:

[0025] 1. Genetic Analysis of Lettuce Heading Phenotype

[0026] In order to analyze the genetic law of lettuce heading traits, the present invention adopts heading lettuce (phenotype is heading) and romaine lettuce (phenotype is non-heading) to obtain F 1 , further selfing, get F 2 generation groups. to F 2 On behalf of the individuals, the ball phenotype was evaluated, recorded and statistically analyzed, and it was found that F 2 The heading phenotype in the population was a quantitative heritable trait with continuous distribution, implying that the heading phenotype of lettuce was a complex trait controlled by multiple genes.

[0027] 2. Map-based cloning of the LsKN1 gene

[0028] In order to clone the key genes controlling the heading traits of lettuce in the above populations, the analysis method of BSR-seq was adopted in this study. from F 2 In the population, 20 ball-bearing individual plants and 20 non-head-...

Embodiment 2

[0030] Application of Heading Gene LsKN1 in Lettuce Heading

[0031] The full-length sequence of the LsKN1 gene was amplified from the bulbous parent, and the primers were: LsKN1com F: GACCTGCAGGCATGCaagcttTGTCTGTTTCTTTCTACCCAA; LsKN1com R: GCTGGTCACCTGTAATTCAcacgtgGTGTTCTTTATTTTCTACTA, and the amplified target fragment included the sequence shown in SEQ ID NO.1. It was inserted into the pCAMBIA1301 plant expression vector (the vector was linearized by HindIII / PmlI), and transformed into non-heading lettuce (lskn1 / lskn1) under the mediation of Agrobacterium, and a total of 4 transgenic plants were obtained, and each strain All showed the ball phenotype ( figure 1 Middle a). T for one of the transgenic lines 1 According to the analysis of generation head phenotype and genotype (primers for genotype identification: ValLsKN1COM F: CGGTTGTTTATTGGTGTATT; ValLsKN1COM R: CGAGGGTAATGAGGATGAGAC), the individual plants with transgene insertion all showed head head phenotype, while the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant gene engineering, and particularly relates to a separated lettuce gene LsKN1 and an application of the gene to control of the heading character oflettuce. A nucleotide sequence of the gene is as shown in SEQ ID NO.1. The invention also relates to a CACTA transposon inserted in a first exon of the heading gene LsKN1. A result of agrobacterium-mediated transformation of non-head lettuce shows that the gene LsKN1 can enable the leaves of the non-head lettuce to be bent inwards to generate head phenotypes. The gene LsKN1 is the first heading character control gene identified in the lettuce, a new direction is opened up for mechanism research of plant heading, and gene resources and theoretical guidance are provided for variety breeding ofhead vegetables.

Description

technical field [0001] This patent belongs to the technical field of plant engineering. In particular, it relates to an isolated lettuce LsKN1 gene and its application in controlling the heading traits of lettuce. Background technique [0002] Lettuce belongs to the Asteraceae Lactuca genus, which is native to the Mediterranean region and is an important vegetable crop. Depending on its morphology, lettuce can be further divided into different horticultural types, including head lettuce, loose leaf lettuce, butter lettuce, romaine lettuce, oil lettuce, and lettuce. Leaf lettuce is also collectively referred to as lettuce. Heading lettuce is a very important class of leaf lettuce, which is characterized by leaves curling inwards and wrapped around each other to form a spherical structure composed of leaves. Compared with other lettuces, head lettuce has a better taste experience, so it is favored by consumers. Worldwide, head lettuce accounts for half of all lettuce produ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/14
CPCC07K14/415C12N15/8216C12N15/8261
Inventor 匡汉晖余长春严承欢
Owner HUAZHONG AGRI UNIV