Gene expression component, constructed cloning vector and application
A gene expression and cloning vector technology, applied in the fields of molecular biology and genetic engineering, can solve problems such as low genome copy number, screening positive clones, inability to use blue-white phenotype, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0084] Example 1 Construction of pWizard plasmid
[0085] (1) Design and synthesize the gene expression module bla-α-RBS-ω shown in SEQ ID NO:3, the full length of the sequence is 3700bp, wherein, from the 5' end, the reverse complementary sequence of the 146th to 3127th bp is the LacZω gene , encoding ω peptide, the reverse complementary sequence of 3128~3176bp is RBS sequence, which initiates the transcription and translation of LacZω gene, the reverse complementary sequence of 3177~3542bp is LacZα gene, encoding α peptide, and 3445~3533bp is polyclonal Site (MCS) sequence, the reverse complementary sequence of 3543-3692bp is the bla promoter;
[0086] (2) Designing and synthesizing the pBR322 replicon shown in SEQ ID NO: 4, the full-length sequence is 1030bp, and from the 5' end, the 265th to 947th bp is the pBR322 gene sequence;
[0087] (3) Designing and synthesizing the Kan gene shown in SEQ ID NO: 5, the total length of the sequence is 1055bp, starting from the 5' end,...
Embodiment 2
[0092] Example 2 Escherichia coli transformed with pWizard plasmid forms blue spots under non-IPTG induction conditions
[0093] (1) Add about 50ng of pWizard plasmid to Top10F', DH5α, and STBL3 competent cells, respectively, and add about 50ng of pUC57 plasmid (preserved by Jinweizhi) to Top10F', DH5α, and STBL3 competent cells. At the same time, absorb about 50ng pET-30a plasmid (preserved by Jinweizhi) was added to STBL3 competent cells;
[0094] (2) Ice bath for 30 minutes;
[0095] (3) Heat shock at 42°C for 90s, and ice bath for 3min;
[0096] (4) Add 700 μL of preheated LB medium to the competent cells, and recover at 37°C and 220 rpm for 1 hour;
[0097] (5) Take an appropriate amount of bacterial solution from the competent cells transformed with pWizard plasmids and evenly spread it on the LB plate containing X-gal and Kan resistance. At the same time, draw appropriate amount from the competent cells transformed with pUC57 and pET-30a plasmids The bacterial soluti...
Embodiment 3
[0101] Example 3 Cloning of exogenous DNA fragments using pWizard plasmid blunt ends
[0102] (1) Using λDNA as a template, F-λDNA-Blunt and R-λDNA-Blunt as primers for PCR amplification, the PCR amplification system and amplification procedures are shown in Table 1 and Table 2;
[0103] F-λ DNA-Blunt (SEQ ID NO: 7): ACGTTTGAGCAGAATAACCATGTGG;
[0104] R-λ DNA-Blunt (SEQ ID NO: 8): AAATAACGTTTCTCCACCGACCTCTG;
[0105] Table 1
[0106] Reagent Dosage wxya 2 o
75μL 5×Buffer 20 μL dNTP 1μL F-λDNA-Blunt 1μL R-λDNA-Blunt 1μL Lambda DNA 1μL pfu 1μL total capacity 100μL
[0107] Table 2
[0108]
[0109] (2) After the PCR reaction, use 1% agarose gel for electrophoresis detection, the size of the target fragment is 600bp, cut the gel of the target fragment, use the gel recovery kit of Axygen Company to recover and purify, and use Nanodrop2000 to measure the concentration of purified DNA About 120ng / μL;...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


