Supercharge Your Innovation With Domain-Expert AI Agents!

Gene expression component, constructed cloning vector and application

A gene expression and cloning vector technology, applied in the fields of molecular biology and genetic engineering, can solve problems such as low genome copy number, screening positive clones, inability to use blue-white phenotype, etc.

Pending Publication Date: 2020-07-07
GENEWIZ INC SZ
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the existing vectors with blue-white screening function, such as the widely used pUC series vectors, have the following disadvantages: First, the scope of application of strains is limited, and this vector is only suitable for β-galactosidase-deficient Genetically engineered bacteria, but Escherichia coli without mutations in β-galactosidase are often used in practical applications, such as STBL2 and STBL3 strains, which cannot use the blue-white phenotype to screen positive clones; second, each Escherichia coli contains a lower Genome copy number leads to low expression of omega peptide. When the strain is transformed into a plasmid expressing α peptide, the content of β-galactosidase is low, and it takes a long time for the strain to form obvious blue spots. Low, affecting production efficiency and large-scale industrial application; third, this carrier needs to use a plate containing IPTG, but IPTG is expensive and toxic to the human body, with high cost and low safety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene expression component, constructed cloning vector and application
  • Gene expression component, constructed cloning vector and application
  • Gene expression component, constructed cloning vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1 Construction of pWizard plasmid

[0085] (1) Design and synthesize the gene expression module bla-α-RBS-ω shown in SEQ ID NO:3, the full length of the sequence is 3700bp, wherein, from the 5' end, the reverse complementary sequence of the 146th to 3127th bp is the LacZω gene , encoding ω peptide, the reverse complementary sequence of 3128~3176bp is RBS sequence, which initiates the transcription and translation of LacZω gene, the reverse complementary sequence of 3177~3542bp is LacZα gene, encoding α peptide, and 3445~3533bp is polyclonal Site (MCS) sequence, the reverse complementary sequence of 3543-3692bp is the bla promoter;

[0086] (2) Designing and synthesizing the pBR322 replicon shown in SEQ ID NO: 4, the full-length sequence is 1030bp, and from the 5' end, the 265th to 947th bp is the pBR322 gene sequence;

[0087] (3) Designing and synthesizing the Kan gene shown in SEQ ID NO: 5, the total length of the sequence is 1055bp, starting from the 5' end,...

Embodiment 2

[0092] Example 2 Escherichia coli transformed with pWizard plasmid forms blue spots under non-IPTG induction conditions

[0093] (1) Add about 50ng of pWizard plasmid to Top10F', DH5α, and STBL3 competent cells, respectively, and add about 50ng of pUC57 plasmid (preserved by Jinweizhi) to Top10F', DH5α, and STBL3 competent cells. At the same time, absorb about 50ng pET-30a plasmid (preserved by Jinweizhi) was added to STBL3 competent cells;

[0094] (2) Ice bath for 30 minutes;

[0095] (3) Heat shock at 42°C for 90s, and ice bath for 3min;

[0096] (4) Add 700 μL of preheated LB medium to the competent cells, and recover at 37°C and 220 rpm for 1 hour;

[0097] (5) Take an appropriate amount of bacterial solution from the competent cells transformed with pWizard plasmids and evenly spread it on the LB plate containing X-gal and Kan resistance. At the same time, draw appropriate amount from the competent cells transformed with pUC57 and pET-30a plasmids The bacterial soluti...

Embodiment 3

[0101] Example 3 Cloning of exogenous DNA fragments using pWizard plasmid blunt ends

[0102] (1) Using λDNA as a template, F-λDNA-Blunt and R-λDNA-Blunt as primers for PCR amplification, the PCR amplification system and amplification procedures are shown in Table 1 and Table 2;

[0103] F-λ DNA-Blunt (SEQ ID NO: 7): ACGTTTGAGCAGAATAACCATGTGG;

[0104] R-λ DNA-Blunt (SEQ ID NO: 8): AAATAACGTTTCTCCACCGACCTCTG;

[0105] Table 1

[0106] Reagent Dosage wxya 2 o

75μL 5×Buffer 20 μL dNTP 1μL F-λDNA-Blunt 1μL R-λDNA-Blunt 1μL Lambda DNA 1μL pfu 1μL total capacity 100μL

[0107] Table 2

[0108]

[0109] (2) After the PCR reaction, use 1% agarose gel for electrophoresis detection, the size of the target fragment is 600bp, cut the gel of the target fragment, use the gel recovery kit of Axygen Company to recover and purify, and use Nanodrop2000 to measure the concentration of purified DNA About 120ng / μL;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene expression component, a constructed cloning vector and application. The gene expression component encodes beta-galactosidase alpha peptide and omega peptide; the gene expression component includes a constitutive promoter, and the constitutive promoter promotes an expressed LacZ[alpha] gene and LacZ[omega] gene. The constitutive promoter is used to regulate the expression of the LacZ[alpha] gene and LacZ[omega] gene, a constructed pWizard plasmid can produce substances with beta-galactosidase activity in a host cell without IPTG induction, the application scope ofthe host cell is expanded, the pWizard plasmid is a high-copy plasmid, therefore, the copy number of the LacZ[alpha] gene and the LacZ[omega] gene in a host bacteria is high, the expression amount ofthe host cell to an enzyme with beta-galactosidase activity is significantly increased, the color development effect and the color development speed are enhanced, and the color development time is shortened.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and relates to a gene expression component and its constructed cloning vector and application, in particular to a gene expression component encoding β-galactosidase α peptide and ω peptide, and the constructed Cloning vector and its construction method and application. Background technique [0002] PCR is an important technique in the fields of molecular biology and genetic engineering, and experimenters often need to clone PCR products into vectors. Currently commonly used cloning vectors are mainly based on the principle of blue-white screening. The blue-white screening method brings great convenience for picking positive clones. The vector that can be used for blue-white screening contains a lacZ' gene, which can encode an α-peptide chain, and contains a multiple cloning site (MCS) for cloning foreign DNA in the lacZ' gene. Existing vectors with blue-white ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66C12N1/21C12N15/10C12R1/19
CPCC12N15/70C12N9/2402C12Y302/01022C12N2830/34C12N2800/22
Inventor 薛高旭夏立军陈业方其张艳吴昕廖国娟
Owner GENEWIZ INC SZ
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More