Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers for detecting rabbit hemorrhagic disease viruses and nucleic acid detection method

A detection method and nucleic acid technology, applied in the field of molecular biology, can solve the problems of difficult pathogen diagnosis, time-consuming, low sensitivity, etc., and achieve the effects of reducing detection cost, accurate detection, and simple operation.

Pending Publication Date: 2020-08-04
POULTRY INST SHANDONG ACADEMY OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods generally have problems such as poor specificity, time-consuming, low sensitivity, and false positives, which make pathogenic diagnosis always a difficult problem. Therefore, it is particularly important to find a fast and accurate method for diagnosing RHDV virus infection.
[0004] RT-PCR technology is a common technical method in the field of biotechnology at present. It has the advantages of strong specificity and high sensitivity. However, the result judgment needs to rely on electrophoresis measurement, which is not only time-consuming and laborious, but also the reaction product is prone to contamination, resulting in false positive results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers for detecting rabbit hemorrhagic disease viruses and nucleic acid detection method
  • Primers for detecting rabbit hemorrhagic disease viruses and nucleic acid detection method
  • Primers for detecting rabbit hemorrhagic disease viruses and nucleic acid detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0045] 1. Primer design

[0046] The specific primers for detecting RHDV described in this embodiment, its corresponding specific amplification fragment is located between the 212-585th sites of the RHDVVP60 gene, with a size of 374bp, and the sequence structure of the specific amplification fragment is specifically: :

[0047] 5'- ACTTCTACTACAATG ATGTTTTCACTTGGTCAGTCGCGGACGCACCCGGCAGCATTCTCTACACTGTCCAACACTCTCCACAGAACAACCCATTCACAGCTGTACTGAGCCAGATGTACGCTGGCTGGGCTGGTGGCATGCAGTTCCGCTTCATAGTTGCTGGATCAGGTGTGTTTGGTGGGCGACTGGTCGCGGCTGTGATACCACCAGGCATCGAGATTGGGCCAGGGTTGGAGGTCAGGCAATTTCCTCATGTTGTTATCGACGCCCGTTCACTCGAACCTGTTACCATCACCATGCCAGACTTGCGTCCCAACATGTACCATCCAACTGGTGACCCTGGCCTTGTCCCCACA CTAGTCCTTAGTG TTTAC -3'.

[0048] According to the RHDV VP60 gene sequence registered in GenBank, the primers are designed, and the primers include the upstream primer F and the downstream primer R, wherein the 5' end of the upstream primer contains a Tag sequence, that is, tag: 5'-CTTTCTTAATA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology, and relates to a biological detection technology, in particular to a specific primer for detecting rabbit hemorrhagic disease virus and an MFIA xTAG detection method. The specific primer for detecting the RHDV is a specific primer designed according to a VP60 gene sequence of the RHDV, and on the basis of the properties of the specific primer, a liquid chip detection method suitable for rapidly and accurately detecting the RHDV is further optimized and established. Compared with a traditional detection method, the method integrates the RT-PCR and liquid chip detection, so that the use amount of detection samples is small, the lowest virus detection amount is 0.1 LD50, the sensitivity is 100 times that of traditional RT-PCR,operation is easy and rapid, the detection cost can be greatly reduced, and rapid and accurate detection of RHDV is achieved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and relates to a biological detection technology, in particular to a specific primer for detecting rabbit haemorrhagic disease virus and a detection method of MFIA xTAG. Background technique [0002] Rabbit hemorrhagic disease, also known as rabbit plague, rabbit viral hemorrhagic pneumonia, rabbit hemorrhagic pneumonia, or rabbit viral sepsis, is a severe infectious disease of rabbits caused by rabbit viral hemorrhagic disease virus (RHDV) , which is characterized by strong infectivity, congestion and hemorrhage in parenchymal organs, and extremely high morbidity and mortality. Rabbit hemorrhagic disease only occurs among rabbits. Rabbits over 3 months old are the most susceptible. It often shows explosive epidemics and causes devastating losses to the rabbit breeding industry. [0003] RHDV is a member of the genus Lagovirus in the caliciviridae family, and is related to European hare...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6816C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6816C12Q2521/107C12Q2531/113
Inventor 黄兵马秀丽于可响刘存霞姜亦飞张连芝庞玉倩史玉颖胡峰宋敏训
Owner POULTRY INST SHANDONG ACADEMY OF AGRI SCI