Application of DNA tetrahedron in preparation of drug for promoting myoblast proliferation
A technology of myoblasts and tetrahedrons, applied in the direction of drug combinations, pharmaceutical formulations, organic active ingredients, etc., can solve problems such as TDN that have not yet been seen, achieve sustained muscle regeneration effects, improve cell autophagy, and promote myogenesis The effect of cell proliferation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Synthesis and identification of embodiment 1TDN
[0039] 1. Synthesis method
[0040] Dissolve the four DNA single strands (S1, S2, S3, S4) in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, and rapidly heat to 95 Keep the temperature at ℃ for 10 minutes, then quickly cool down to 4℃ and keep it for more than 20 minutes, then you can get TDN.
[0041] The sequences of the four single strands (5'→3') are as follows:
[0042] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)
[0043] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2)
[0044] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3)
[0045] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4)
[0046] 2. Identification
[0047] After the synthesis of TDN, capillary electrophoresis shows that the size of TDN...
experiment example 1
[0049] In vitro experiment of experimental example 1 cell proliferation
[0050] 1. Method
[0051] The myoblast cell line - C2C12 cells were cultured in the well plate, and the cells had adhered to the wall after 24 hours. Incubate in medium containing 0nM, 2.5nM, 125nM, 250nM TDN solutions; after 24 hours of incubation, use CCK-8, EDU imaging and EDU flow cytometry to detect the proliferation of myoblasts.
[0052] 1.1 CCK-8 cell activity detection Myoblast cell line—C2C12 cells were cultured in 96-well plates (5×10 3 cells / well), the cells had adhered to the wall after 24 hours. Replace the original medium, and incubate C2C12 cells in the medium containing 0nM, 2.5nM, 125nM, 250nM, 375nM TDN solution respectively; after incubation for 24 hours, remove the medium, wash once with PBS, then add serum-free DMEM and 10% (v / v) CCK-8 solution, after incubation at 37°C for 2 hours, detect the OD value of each group at a wavelength of 450nm.
[0053] 1.2 EDU imaging C2C12 cells ...
experiment example 2
[0062] Experimental example 2 In vitro experiment of cell autophagy
[0063] 1. Method
[0064] 1.1 Gene detection The myoblast cell line - C2C12 cells were incubated in the culture medium containing 0 μM (control group) and 250 μM (experimental group) TDN solution, and the samples were collected after 24 hours, and the RNA was extracted respectively, and the RNA was reverse transcribed to obtain cDNA. The expression levels of autophagy-related genes LC3 and p62 were detected by qPCR.
[0065] 1.2 Western blot protein detection The myoblast cell line - C2C12 cells were incubated in the culture medium containing 0 μM (control group) and 250 μM (experimental group) TDN solution, and the samples were collected after 24 hours, and the intracellular proteins were extracted respectively, and analyzed by Western blot The expression levels of autophagy-related genes Beclin1 and LC3 were detected respectively.
[0066] 1.3 Immunofluorescent protein detection The myoblast cell line - ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com