Application of DNA tetrahedron in preparation of drug for promoting myoblast proliferation

A technology of myoblasts and tetrahedrons, applied in the direction of drug combinations, pharmaceutical formulations, organic active ingredients, etc., can solve problems such as TDN that have not yet been seen, achieve sustained muscle regeneration effects, improve cell autophagy, and promote myogenesis The effect of cell proliferation

Active Publication Date: 2020-08-07
SICHUAN UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There is no report on the relat...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DNA tetrahedron in preparation of drug for promoting myoblast proliferation
  • Application of DNA tetrahedron in preparation of drug for promoting myoblast proliferation
  • Application of DNA tetrahedron in preparation of drug for promoting myoblast proliferation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Synthesis and identification of embodiment 1TDN

[0039] 1. Synthesis method

[0040] Dissolve the four DNA single strands (S1, S2, S3, S4) in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, and rapidly heat to 95 Keep the temperature at ℃ for 10 minutes, then quickly cool down to 4℃ and keep it for more than 20 minutes, then you can get TDN.

[0041] The sequences of the four single strands (5'→3') are as follows:

[0042] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)

[0043] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2)

[0044] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3)

[0045] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4)

[0046] 2. Identification

[0047] After the synthesis of TDN, capillary electrophoresis shows that the size of TDN...

experiment example 1

[0049] In vitro experiment of experimental example 1 cell proliferation

[0050] 1. Method

[0051] The myoblast cell line - C2C12 cells were cultured in the well plate, and the cells had adhered to the wall after 24 hours. Incubate in medium containing 0nM, 2.5nM, 125nM, 250nM TDN solutions; after 24 hours of incubation, use CCK-8, EDU imaging and EDU flow cytometry to detect the proliferation of myoblasts.

[0052] 1.1 CCK-8 cell activity detection Myoblast cell line—C2C12 cells were cultured in 96-well plates (5×10 3 cells / well), the cells had adhered to the wall after 24 hours. Replace the original medium, and incubate C2C12 cells in the medium containing 0nM, 2.5nM, 125nM, 250nM, 375nM TDN solution respectively; after incubation for 24 hours, remove the medium, wash once with PBS, then add serum-free DMEM and 10% (v / v) CCK-8 solution, after incubation at 37°C for 2 hours, detect the OD value of each group at a wavelength of 450nm.

[0053] 1.2 EDU imaging C2C12 cells ...

experiment example 2

[0062] Experimental example 2 In vitro experiment of cell autophagy

[0063] 1. Method

[0064] 1.1 Gene detection The myoblast cell line - C2C12 cells were incubated in the culture medium containing 0 μM (control group) and 250 μM (experimental group) TDN solution, and the samples were collected after 24 hours, and the RNA was extracted respectively, and the RNA was reverse transcribed to obtain cDNA. The expression levels of autophagy-related genes LC3 and p62 were detected by qPCR.

[0065] 1.2 Western blot protein detection The myoblast cell line - C2C12 cells were incubated in the culture medium containing 0 μM (control group) and 250 μM (experimental group) TDN solution, and the samples were collected after 24 hours, and the intracellular proteins were extracted respectively, and analyzed by Western blot The expression levels of autophagy-related genes Beclin1 and LC3 were detected respectively.

[0066] 1.3 Immunofluorescent protein detection The myoblast cell line - ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a drug for promoting myoblast proliferation and improving myoblast autophagy level, which is characterized in that the active ingredient of the drug is DNA tetrahedron. The invention also provides a new drug for promoting muscle regeneration, which is prepared by taking a DNA tetrahedron as an active ingredient and adding pharmaceutically acceptable auxiliary materials. Theinvention provides the new application of the DNA tetrahedron in preparation of muscle regeneration promoting drugs, and the DNA tetrahedron has a very good application prospect.

Description

technical field [0001] The invention relates to the field of nucleic acid medicines, in particular to the use of DNA tetrahedrons in the preparation of medicines for promoting myoblast proliferation. Background technique [0002] Myoblast is a small flat or cuboidal cell located between the muscle cell membrane and the basement membrane, which is differentiated from the myogenic section of the embryo and the mesenchymal cells everywhere. Myoblasts are considered to be myogenic stem cells with proliferation and differentiation potential, and have the ability to self-renew and differentiate new town muscle fibers. Under physiological conditions, myoblasts are in an undifferentiated state. Under stress conditions such as injury and degeneration, they can be activated, proliferate, and differentiate into new muscle fibers. [0003] The use of myoblast transplantation is expected to repair inherited muscular tissue myopathy or muscle trauma. A number of related studies are also...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/711A61P21/00
CPCA61K31/711A61P21/00
Inventor 林云锋高阳蔡潇潇
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap