ITS (Internal Transcribed Spacer) used for identification of lepidium meyenii and accurate identification method of lepidium meyenii
A sequence and maca technology, applied in biochemical equipment and methods, resistance to vector-borne diseases, measurement/inspection of microorganisms, etc., can solve problems such as interference from microbial contamination, achieve low cost, and facilitate large-scale promotion and use , the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0020] Example 1: Obtaining the sequence of the rbcL region of maca samples
[0021] 1. DNA extraction of samples to be tested
[0022] (1) Multiple maca samples were collected from different origins, as shown in Table 1.
[0023] Table 1: Maca sample collection information
[0024] serial number sample Sampling site collection place 1 Maca the root Yunnan 2 Maca the root Tibet 3 Maca the root sichuan
[0025] (2) Adopt CTAB method to carry out DNA extraction to the sample to be tested in Table 1, concrete operation is as follows:
[0026] 1) Soak the sample to be tested in 75% ethanol for 5 minutes, then take it out, and place it in a sterile environment to air dry naturally.
[0027] 2) Take 2g of the sample to be tested, add liquid nitrogen and grind it into powder, put it in a 10mL centrifuge tube, then add 4.5mL of 3×CTAB extract preheated at 65°C, 0.5mL of SDS and mix well, then bathe in water at 65°C for 1h, and Shake...
Embodiment 2
[0053] Compared with Example 1, the difference is that the Maca in Example 1 is prepared into a powder, and the powder is used as a sample to extract DNA for identification. As a result, the above-mentioned 8 bases can also be specifically detected point.
[0054] SEQ ID NO: 1
[0055] tatactcctg aatatgaaac caaggatact gatatcttgg cagcattccg agtaactcct
[0056] caacccggag ttccacctga agaagcaggg gctgcggtag ctgctgaatc ttctactggt
[0057] acatggacaa ctgtgtggac cgatgggctt accagccttg atcgttacaa aggacgatgc
[0058] taccacatcg agcccgttcc aggagaagaa agtcaattta ttgcgtatgt agcttaccca
[0059] ttagaccttt ttgaagaagg ttcggttatact aacatgttta cctcgattgt gggtaatgta
[0060] tttgggttca aagccctggc tgctctacgt ctagaggatc tgcgaatccc tcctgcttat
[0061] actaaaactt tccagggacc gcctcatggt atccaagttg aaagagataa attgaacaag
[0062] tatggacgtc ccctattagg atgtactatt aaaccaaaat tgggattatc tgcgaagaac
[0063] tatggtagag cagttt
[0064] SEQ ID NO: 2
[0065] atgtcaccacaaacagagactaaagc
[0066] SEQ ID ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More