Amphibian mitochondria general macro bar code amplification primers and application method thereof
A technology of amphibians and meta-barcoding, which is applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., can solve problems such as limiting the research and protection of amphibian community diversity, and difficult sequencing of products. Achieve the effect of improving the diversity research of macrobarcode, ensuring the resolution of species, and strong versatility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] This embodiment provides that the present invention provides an amphibian mitochondrial 12S-16S universal macrobarcode amplification primer, which includes a primer pair consisting of at least one upstream primer and one downstream primer,
[0048] The upstream primer sequence is Am312-F1: TAGAGGAGCCTGTNCTATAATCGAT;
[0049] Am246-F2: CGCCTGTTTACCAAAAACATCGCCT;
[0050] Am250-F3: ACGAGAAGACCCNATGGAGCTT;
[0051] The downstream primer sequence is Am312-R1: GAAGAGGGNGACGGGCGGTGTGT;
[0052] Am246-R2: AAGTCCATNGGGTCTTCTCGT;
[0053] Am250-R3.1: CGCTGTTATCCCNAGGGTAACTTG;
[0054] Am305-R3.2: ATCCAACATCGAGGTCGTAAACC;
[0055] Am387-R3.3: CCGGTCTGAACTCAGATCACGTAGG;
[0056] Table 1 shows the universal primer pair combination list of the amphibian mitochondrial 12S-16S gene macrobarcode of the present invention. The preferred primer pair combination of the upstream primer and the downstream primer is: (1) Am312-F1 and Am312-R1 combination, (2) Am246-F2 and Am246-R2 combination, (3) Am250-F...
Embodiment 2
[0060] The amphibian sample in this example comes from the Nanjing Institute of Environmental Science of the Ministry of Ecology and Environment. A total of 30 species of amphibians have been collected from toe samples, belonging to 2 orders, 10 families, 25 genera and 30 species, covering a wide range and strong species representation The information of 30 amphibians used to verify the amplification primers is shown in Table 2.
[0061] Table 2 Information of 30 amphibians used to verify amplification primers
[0062]
[0063]
[0064] Extract the DNA of each amphibian sample separately, using Qubit TM dsDNA HS Assay Kits are used to determine the DNA concentration. According to the measurement results, the DNA of each species is diluted to the same concentration of 10ng / μL, and the same volume of DNA solution for each species is mixed together to form a mixture containing 30 amphibian tissue DNA Solution.
[0065] The 5 primer combinations described in Table 1 in Example 1 (Am31...
Embodiment 3
[0072] The Ion Torrent PGM sequencer was used to perform high-throughput sequencing on the amplified products of the 12S~16S designed primers and literature primers in Example 2, and the Ion Xpress special kit for the sequencer was used before sequencing. TM Plus Region Library Kit (Life Technologies, USA) was used to construct the sequencing library, and the Ion Proton HiQ Sequencing Kit was used to select PI v2 chips for sequencing in accordance with standard instrument operations. The sequencing results were output in Fastq format and performed on the QIIME2 software platform based on the Linux system. Sequence pre-processing (the process is as follows): filter the sequences with low sequencing quality values and sequence lengths shorter than 150bp, according to the corresponding barcode (added when the sequencing library is built, belonging to the reagents of the sequencing kit), the sequencing results are divided into different samples After classification, use UCHIME so...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap