Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Amphibian mitochondria general macro bar code amplification primers and application method thereof

A technology of amphibians and meta-barcoding, which is applied in biochemical equipment and methods, measurement/testing of microorganisms, DNA/RNA fragments, etc., can solve problems such as limiting the research and protection of amphibian community diversity, and difficult sequencing of products. Achieve the effect of improving the diversity research of macrobarcode, ensuring the resolution of species, and strong versatility

Pending Publication Date: 2020-08-18
南京易基诺环保科技有限公司
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] In view of the fact that the existing primers are difficult to meet the characteristics of strong specificity and versatility at the same time, and the amplified products are difficult to sequence on a high-throughput sequencing platform, this greatly limits the research on the diversity of amphibian communities by metabarcoding In order to solve the problem of protection, the present invention provides a general macrobarcode amplification primer for amphibian mitochondria 12S-16S, which can have the advantages of high specificity and versatility at the same time, and can amplify PCR products ranging in length from 240bp to 400bp , to meet the requirements of different high-throughput sequencing platforms, suitable for the detection and identification of multiple species of amphibians

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amphibian mitochondria general macro bar code amplification primers and application method thereof
  • Amphibian mitochondria general macro bar code amplification primers and application method thereof
  • Amphibian mitochondria general macro bar code amplification primers and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] This embodiment provides that the present invention provides an amphibian mitochondrial 12S-16S universal macrobarcode amplification primer, which includes a primer pair consisting of at least one upstream primer and one downstream primer,

[0048] The upstream primer sequence is Am312-F1: TAGAGGAGCCTGTNCTATAATCGAT;

[0049] Am246-F2: CGCCTGTTTACCAAAAACATCGCCT;

[0050] Am250-F3: ACGAGAAGACCCNATGGAGCTT;

[0051] The downstream primer sequence is Am312-R1: GAAGAGGGNGACGGGCGGTGTGT;

[0052] Am246-R2: AAGTCCATNGGGTCTTCTCGT;

[0053] Am250-R3.1: CGCTGTTATCCCNAGGGTAACTTG;

[0054] Am305-R3.2: ATCCAACATCGAGGTCGTAAACC;

[0055] Am387-R3.3: CCGGTCTGAACTCAGATCACGTAGG;

[0056] Table 1 shows the universal primer pair combination list of the amphibian mitochondrial 12S-16S gene macrobarcode of the present invention. The preferred primer pair combination of the upstream primer and the downstream primer is: (1) Am312-F1 and Am312-R1 combination, (2) Am246-F2 and Am246-R2 combination, (3) Am250-F...

Embodiment 2

[0060] The amphibian sample in this example comes from the Nanjing Institute of Environmental Science of the Ministry of Ecology and Environment. A total of 30 species of amphibians have been collected from toe samples, belonging to 2 orders, 10 families, 25 genera and 30 species, covering a wide range and strong species representation The information of 30 amphibians used to verify the amplification primers is shown in Table 2.

[0061] Table 2 Information of 30 amphibians used to verify amplification primers

[0062]

[0063]

[0064] Extract the DNA of each amphibian sample separately, using Qubit TM dsDNA HS Assay Kits are used to determine the DNA concentration. According to the measurement results, the DNA of each species is diluted to the same concentration of 10ng / μL, and the same volume of DNA solution for each species is mixed together to form a mixture containing 30 amphibian tissue DNA Solution.

[0065] The 5 primer combinations described in Table 1 in Example 1 (Am31...

Embodiment 3

[0072] The Ion Torrent PGM sequencer was used to perform high-throughput sequencing on the amplified products of the 12S~16S designed primers and literature primers in Example 2, and the Ion Xpress special kit for the sequencer was used before sequencing. TM Plus Region Library Kit (Life Technologies, USA) was used to construct the sequencing library, and the Ion Proton HiQ Sequencing Kit was used to select PI v2 chips for sequencing in accordance with standard instrument operations. The sequencing results were output in Fastq format and performed on the QIIME2 software platform based on the Linux system. Sequence pre-processing (the process is as follows): filter the sequences with low sequencing quality values ​​and sequence lengths shorter than 150bp, according to the corresponding barcode (added when the sequencing library is built, belonging to the reagents of the sequencing kit), the sequencing results are divided into different samples After classification, use UCHIME so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene detection, and discloses amphibian mitochondria general macro bar code amplification primers and an application method thereof. The amplification primers comprise a primer pair formed by combining at least one forward primer and one reverse primer. Products obtained by PCR amplification through combination of Am312-F1 and Am312-R1, combination of Am246-F2 and Am246-R2, combination of Am250-F3 and Am250-R3.1, combination of Am250-F3 and Am305-R3.2 and combination of Am250-F3 and Am387-R3.3 meet the requirements of next-generation sequencing and can be used for species identification and diversity analysis of amphibians; through flexible combination of the above primer pairs, the research purposes of amphibian species classification, phylogenetic relationship, systematic geography and the like can be achieved.

Description

Technical field [0001] The invention belongs to the technical field of gene detection, and specifically relates to an amphibian mitochondrial universal macrobarcode amplification primer and an application method thereof. Background technique [0002] Amphibians are primitive, newly landed, five-toed variable temperature quadrupeds with bare skin, numerous secretory glands, and mixed blood circulation. There is a metamorphosis in its ontogeny cycle, that is, larvae that live in water with gills (new organs) breathe, complete metamorphosis in a short time, and become adults that can live on land with lung breathing. There are 3 orders, about 40 families, 400 genera, and 4000 species. Except for Antarctica and maritime islands, all over the world. According to the records of Chinese amphibians http: / / www.amphibiachina.org / , there are more than 520 species in 61 genera and 13 families in China, which are mainly distributed in the south of the Qinling Mountains, western China and mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6869C12N15/11
CPCC12Q1/6888C12Q1/6869C12Q2600/156C12Q2531/113C12Q2535/122C12Q2563/185
Inventor 张靖雯杨江华张效伟
Owner 南京易基诺环保科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com