Supercharge Your Innovation With Domain-Expert AI Agents!

Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor Fok1 site based on probe method

A primer composition, probe method technology, applied in biochemical equipment and methods, microbial determination/inspection, recombinant DNA technology, etc. The effect of strong processing capacity, low pollution risk and low price

Pending Publication Date: 2020-08-28
CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is the same problem of aerosol pollution; and in the result judgment process, gel electrophoresis is required, which involves many cumbersome links such as gel preparation, sample spotting, gel running, imaging, etc., which are prone to errors and require more manpower; and The results are presented in the form of pictures, and the interpretation process relies on subjective factors, which is prone to errors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor Fok1 site based on probe method
  • Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor Fok1 site based on probe method
  • Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor Fok1 site based on probe method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention.

[0035] The primer composition for realizing the accurate typing of the vitamin D receptor Fok1 site based on the probe method includes:

[0036] VDR gene Fok1 (rs2228570) forward amplification primer:

[0037] CTGGCCCTGGCACTGACTCTGGCTCT (corresponding to SEQ No.1 in the sequence listing);

[0038] VDR gene Fok1 (rs2228570) reverse amplification primer:

[0039] GGTCAAAGTCTCCAGGGTCAGG (corresponding to SEQ No.2 in the sequence listing);

[0040] VDR gene Fok1 (rs2228570) genotype T probe:

[0041] 5'-CTTACAGGGATGGAG-3' (corresponding to SEQ No.3 in the sequence listing);

[0042] VDR gene Fok1 (rs2228570) genotype C probe:

[0043] 5'-CTTACAGGGACGGAG-3' (correspo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer composition, reagent, detection method and system for realizing accurate typing of a vitamin D receptor Fok1 site based on a probe method. The primer composition for realizing accurate typing of the vitamin D receptor Fok1 site based on the probe method is primers and probes which are designed according to the polymorphism of the vitamin D receptor gene Fok1 (rs2228570) SNP site. The reagent, detection method and system for realizing accurate typing of the vitamin D receptor Fok1 site based on the probe method are a reagent, detection method and system respectively adopting the primer composition for realizing accurate typing of the vitamin D receptor Fok1 site based on the probe method. The primer composition for realizing accurate typing of the vitamin D receptor Fok1 site based on the probe method provided by the invention solves the technical problems such as expensive equipment, aerosol pollution, and tedious steps in the Fok1 site polymorphism detection in the prior art.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a primer composition, a reagent, a detection method and a system for realizing accurate typing of the vitamin D receptor Fok1 site based on a probe method. Background technique [0002] Vitamin D receptor gene (vitamin D (1,25-dihydroxyvitamin D3) receptor, VDR), located at 12q13.11, with a total length of 63.5kb and 11 exons, the mRNA length is 4,775nt, encoding 428 amino acid residues Constituent vitamin D receptor (VDR) protein, the nuclear hormone receptor for vitamin D3, is also a secondary receptor for gallstone acid. VDRs are transcriptional regulators, members of the steroid hormone / thyroid hormone receptor superfamily, that function as ligand-inducible replication factors. The protein regulates gene expression mainly through a series of metabolic response pathways, including immune response pathways and tumor activation pathways. [0003] A number of domestic and foreign ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2531/113C12Q2563/107
Inventor 周梅华龚强余艳李慧源葛虎陈鹏代冰
Owner CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More