ACE2-Albumin recombinant protein as well as preparation method and application thereof

An ace2-albumin, recombinant protein technology, applied in the biological field, can solve problems such as affecting the structure of ACE2, short half-life time of ACE2 protein, limiting the practical application of ACE2 protein, etc., to improve stability, avoid antibody-dependent enhancement phenomenon, high efficiency Clonal Screening and Effects of Transfected Cells

Inactive Publication Date: 2020-09-08
乾元康安(苏州)生物科技有限公司
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the half-life of ACE2 protein in vivo is very short, which will greatly limit the practical application of ACE2 protein
[0005] The current method to increase the existence time of ACE2 protein in the body is to link ACE2 to the Fc segment of the antibody, but the surface of macrophages and B cells in the body expresses the receptor for the Fc segment of the antibody. If recombinant ACE2-Fc protein is produced, the virus binds to the ACE2 end, and The Fc end of the ACE2-Fc2 recombinant protein combines with macrophages and B cells to undergo endocytosis, thereby mediating the entry of the virus into the host cell through the Fc segment receptor, resulting in an antibody-dependent enhancement (Antibody-dependent enhancement, ADE), resulting in More virus enters host cell
[0006] Another way to increase the existence time of ACE2 protein in vivo is to PEGylate ACE2 protein, but ACE2 protein has many glycosylation sites, after PEGylation, it may affect the structure of ACE2 itself

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ACE2-Albumin recombinant protein as well as preparation method and application thereof
  • ACE2-Albumin recombinant protein as well as preparation method and application thereof
  • ACE2-Albumin recombinant protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Construction of the production vector of ACE2-Albumin: the overall process is attached figure 1 shown.

[0047] The human ACE2 and Albumin gene sequences were retrieved and downloaded from the genome.ucsc.edu website, ACE2 (Genbank No: NM_001371415.1), Albumin (Genbank No: NM_000477.7) sequences.

[0048] The target gene fragment ACE2 was amplified by PCR: using intestinal cDNA as a template, using

[0049] forward primer

[0050] ACE2-5HA-F(XhoI)-ACCACC CCTCGAGATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCCAGTCCACCATTGAGGAACAGGCC (SEQ ID NO. 1),

[0051] The reverse primer ACE2-5HA-R-TCTTGTGTGCAAACTCTAGGCTGTTGTCATTC (SEQ ID NO. 2) was used to amplify the ACE2 fragment by PCR. The underlined sequence is the enzyme cutting site.

[0052] The target gene fragment Albumin was amplified by PCR: using liver cDNA as a template, using the forward primer Albumin-5HA-F-CCTAGAGTTTGCACACAAGAGTGAGGTTGCTC (SEQ ID NO.4),

[0053] reverse primer

[0054]...

Embodiment 2

[0070] Production of ACE2-Albumin recombinant protein:

[0071] (1) Use FreeStyle 293-F cells with FreeStyle TM 293 medium adjusted to 1×106 cells / mL, 30 mL in total;

[0072] (2) Take the pMyc-ACE2-Albumin-IRES-GFP production vector 37.5ug and 0.6mL OptiPRO obtained in Example 1 TM Mix the SFM medium evenly;

[0073] (3) Take 37.5ul FreeStyle TM MAX Reagent reactant with 0.6mL OptiPRO TM Mix the SFM medium evenly and let it stand for 5 minutes;

[0074] (4) Mix the medium obtained in steps 3 and 4 evenly, and let stand for 30 minutes;

[0075] (5) Add 1.2 mL of medium obtained in step 4 into 30 mL of FreeStyle 293-F cells and culture for 7 days. On the fourth day, samples were taken to analyze the transfection of the cells. After 7 days, the ACE2-Albumin recombinant protein was collected. The sequence of the recombinant protein is shown in SEQ Shown in ID NO.11.

Embodiment 3

[0077] Purification of ACE2-Albumin recombinant protein

[0078] (1) Centrifuge 30mL of Ni-NTA Superflow Resin at 700g for 2 minutes, discard the supernatant;

[0079] (2) Add 60mL balance solution and Ni-NTA Superflow Resin, mix evenly, centrifuge at 700g for 2 minutes, and discard the supernatant;

[0080] (3) Centrifuge the cell culture obtained in Example 2 at 300 g for 5 minutes, take the supernatant and add it to the Ni-NTA Superflow Resin obtained in step 2, mix gently for 30 minutes, then centrifuge at 700 g for 2 minutes, discard the supernatant;

[0081] (4) Mix 60mL cleaning solution with Ni-NTA Superflow Resin evenly, centrifuge at 700g for 2 minutes, discard the supernatant, and wash 3 times;

[0082] (5) Mix 30mL eluent with Ni-NTA Superflow Resin evenly, mix gently for 10 minutes, then centrifuge at 700g for 2 minutes, take the supernatant, which contains CSF1-Albumin recombinant protein;

[0083] (6) Use NanoDrop to measure the concentration of ACE2-Albumin r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ACE2-Albumin recombinant protein as well as a preparation method and application thereof. Aiming at the defect of short in-vivo half-life period of existing ACE2 protein, the ACE2 protein and the Albumin protein are subjected to fusion design, so that the in-vivo stability of the ACE2 protein is greatly improved, the half-life period of the ACE2 protein is prolonged, andthe phenomenon of antibody dependence enhancement is avoided. Furthermore, the invention constructs a production vector of the ACE2-Albumin recombinant protein, and provides an efficient method for cloning, screening and transfecting cells. The invention further provides a method for efficiently expressing and purifying the ACE2-Albumin recombinant protein in cells. Preferably, the invention further provides an application method of the ACE2-Albumin recombinant protein in detecting coronaviruses.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to human ACE2-Albumin recombinant protein, a method for designing and manufacturing ACE2-Albumin and the application of the ACE2-Albumin recombinant protein. [0002] technical background [0003] ACE2, also known as ACEH, is known as angiotensin-converting enzyme 2. The protein encoded by this gene belongs to the angiotensin converting enzyme family of dipeptidyl carboxyl dipeptidase and has considerable homology with human angiotensin converting enzyme 1. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and of angiotensin II into the vasodilator angiotensin 1-7. ACE2 has a strong affinity for Ang II type 1 and type 2 receptors and regulates blood pressure, fluid balance, inflammation, cell proliferation, hypertrophy and fibrosis. At the same time, the specific expression of the gene in organs and cells suggests that it may play a role in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N9/48C12N15/62C12N15/85C07K1/22A61K38/48A61K47/64A61P31/14G01N15/14
CPCC12N9/485C12N15/85C12Y304/17023A61K47/643A61P31/14G01N15/14C07K2319/31C12N2800/107A61K38/00G01N2015/1472G01N15/149
Inventor盛剑鹏
Owner乾元康安(苏州)生物科技有限公司