GRNA of WAS gene and application of gRNA

A gene, gene editing technology, applied in DNA/RNA fragments, genetic engineering, gene therapy, etc., can solve problems such as unobserved eczema and joint abnormalities

Active Publication Date: 2020-10-23
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, the animal models of WAS gene knockout are almost all mice. Although these mouse models have indeed made important contributions to the study of Wiskott-Aldrich syndrome, the phenotypes of mouse models and WAS patients still have many differences, such as These mice had mild thrombocytopenia, no severe infection, eczema, and joint abnormalities were not observed; and these WASP-deficient mice had normal growth and survival ability, while WAS patients did not receive appropriate treatment. die before puberty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GRNA of WAS gene and application of gRNA
  • GRNA of WAS gene and application of gRNA
  • GRNA of WAS gene and application of gRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Design and Construction of CRISPR / Cas9 Gene Editing System

[0052] (1) Design gRNA

[0053] This embodiment first analyzes the homology between the rabbit WAS gene and the human WAS gene, as well as the site with a higher mutation frequency of the WAS gene that has been reported to cause Wiskott-Aldrich syndrome, and determines that exon 2 and exon 2 of the rabbit WAS gene Selection of target sites around exon 7;

[0054] Download the rabbit WAS gene sequence from NCBI, according to the selection requirements of the spCas9 gene target site and the transcription requirements of the pT7-gRNA in vitro transcription vector, select the target site around exon 2 and exon 7, and design two gRNAs ( gRNA1 and gRNA2), such as Figure 1A and Figure 1B Shown are the partial sequences of exon 2 and exon 7 of the rabbit WAS gene, and the highlighted sequences are the target sequences of gRNA1 and gRNA2, respectively;

[0055] gRNA1 (SEQ ID NO: 1): ACTTCATCCGCCTTTACGGC;...

Embodiment 2

[0061] Example 2 Preliminary estimation of WAS gene editing efficiency of CRISPR / Cas9 gene editing system

[0062] Collect and select rabbit fertilized eggs before and after the pronuclear stage for use; prepare micromanipulation needles, including fixation needles and injection needles; mix gRNA and Cas9 according to the ratio of gRNA1:gRNA2:Cas9 mRNA=15ng / μL:15ng / μL:200ng / μL mRNA, inject gRNA and Cas9 mRNA mixture into the rabbit fertilized eggs before and after the pronuclear stage; place the injected fertilized eggs in an incubator for culture, collect embryos at about 4 days, and use NP40 lysate (0.45% NP40 and 60 μg / mL proteinase K ) cleavage in a PCR machine, and use the cleavage product as a template to carry out conventional PCR or nested PCR, and the PCR primers are shown in SEQ ID NO: 3-9;

[0063] WAS-2F (SEQ ID NO: 3): CCTCCTCACCTTCCTTCGG;

[0064]WAS-2R (SEQ ID NO:4):TTCTAGGGTTCAGGGATTTGCT;

[0065] WAS-7F (SEQ ID NO: 5): ATGGTTATTAATGGTTTATGGGATC;

[0066] WA...

Embodiment 3

[0073] Example 3 Construction of Wiskott-Aldrich Syndrome Rabbit Model

[0074] (1) Microinjection of fertilized eggs

[0075] Collect and select rabbit fertilized eggs before and after the pronuclear stage for use; prepare micromanipulation needles, including fixation needles and injection needles; mix gRNA and Cas9 according to the ratio of gRNA1:gRNA2:Cas9 mRNA=15ng / μL:15ng / μL:200ng / μL For mRNA, inject the mixture of gRNA and Cas9 mRNA into the cytoplasm of rabbit fertilized eggs before and after the pronuclear stage; the injected fertilized eggs are cultured in an incubator, and embryos in good condition are selected and transplanted into female rabbits.

[0076] (2) Delivery and Nursing

[0077] About 15 days after the embryo transfer, judge whether the recipient female rabbit is pregnant; for the pregnant recipient female rabbit, appropriately increase the feed and green feed such as carrots and vegetables to ensure the nutritional needs of the female rabbit; about 28 d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides gRNA of a WAS gene and application of gRNA. The target sequence of the gRNA is located at an exon 2 and an exon 7 of the WAS gene, and comprises nucleic acid sequences shown asSEQ ID NO: 1 or SEQ ID NO: 2. The target sequence of the gRNA comprises the exon 2 and the exon 7 of the WAS gene. WAS genes in fertilized eggs of rabbits are knocked out, and a constructed Wiskott-Aldrich syndrome rabbit model can accurately simulate the phenotype of the Wiskott-Aldrich syndrome of a human body, is beneficial to better understanding the pathogenic mechanism of the Wiskott-Aldrichsyndrome, and provides important reference for developing an efficient and accurate diagnosis method and providing more effective treatment schemes.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to gRNA of WAS gene and application thereof, in particular to gRNA of WAS gene and application thereof in constructing Wiskott-Aldrich syndrome rabbit model. Background technique [0002] Wiskott-Aldrich syndrome (WAS) is an X-linked recessive genetic disease caused by mutations in the WAS gene. According to the type of gene mutation, WAS protein expression and clinical symptoms, Wiskott-Aldrich syndrome is currently clinically divided into typical WAS, X-linked thrombocytopenia (X-linked thrombocytopenia, XLT), intermittent X-linked thrombocytopenia ( intermittent X-linkedthrombocytopenia, IXLT) and X-linked neutrapenia (X-linked neutrapenia, XLN). Among them, the typical WAS is the most serious. If it is not treated in time, the median survival time of patients is only 10-15 years. [0003] WAS gene is specifically expressed in hematopoietic cells, and its encoded WAS protein (WASP) i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/90C12N5/10A01K67/027C12Q1/02A61K48/00A61P43/00A61P7/04A61P7/00
CPCC12N15/113C12N15/8509C12N5/0604A01K67/0276G01N33/5008A61K48/005A61K48/0008A61P43/00A61P7/04A61P7/00C12N2310/20C12N2800/107C12N2510/00A01K2217/075A01K2227/107A01K2267/0306C12N2503/02G01N2500/10
Inventor赖良学周娟娟廖媛
OwnerGUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI