Specific PCR identification primer for identifying bulbus fritillariae ussuriensis and application of specific PCR identification primer
A kind of fritillary, specific technology, applied in the field of medicine, can solve the problem of identifying no public reports and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0028] Experimental example 1 Sequence download and comparison analysis
[0029] Download the ITS sequences of Fritillaria and other varieties of Fritillaria from the NCBI database, and use MAGA-X for multiple sequence alignment analysis of all sequences to find the difference between the sequence of Fritillaria and other sequences. Based on these SNP positions Dian used the primer design software Oligo7 to design the specific primers of Fritillaria, which were named PB-Y1F and PB-Y1R respectively.
experiment example 2
[0030] Experimental example 2 utilizes the method for specific primer identification flat Fritillaria
[0031] 1. DNA extraction
[0032]The random sampling method was used to take samples. The surface of the sample was wiped with 75% ethanol, and after drying, it was pulverized with a tissue grinder. The total DNA was extracted according to the instructions of the Tiangen Express Plant Genomic DNA Extraction Kit, and the concentration and absorbance (A260 / A280) of the extracted DNA were detected using an ultra-micro-volume ultraviolet spectrophotometer, and the obtained DNA samples were stored at -20 °C spare. Use universal primers ITS2F: 5' ATGCGATACTTGGTGTGAAT 3'; ITS2R: 5'GACGCTTCTCCAGACTACAAT 3' for PCR reaction to detect the quality of template DNA. The total volume of the PCR reaction system was 25 μL, including 12.5 μL of 2×Taq Plus Master Mix, 1 μL (10 μmol) of upstream and downstream primers, 1 μL of DNA template, and 9.5 μL of ddH2O. PCR reaction conditions: 94°C...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap