Helicobacter pylori mutant strain capable of stimulating immune response and construction method and application thereof
A technology of Helicobacter pylori, immune response, applied in the field of bioengineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] 1. ΔfutB primer design and PCR amplification
[0058] According to the reported sequence of Helicobacter pylori 26695 strain (GCA_000008525.1 with reference to the GenBank sequence number), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the futB gene respectively, and the amplified fragment sizes were 670bp and 600bp, the above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:
[0059] futB left-up: 5'GCTGCAGCTTTAGCCATTGCGGGTTTG 3'
[0060] futB left-down: 5'CGGAATTCCGggtcatgaccccattattgaatg'
[0061] futB right-up: 5'CGGGATCCCG gatgtggcgtagtctcagg 3'
[0062] futB right-down: 5'CCATCGATGGgtgccaccggcatcaatac 3'
[0063] 2. Amplification of the upper and lower homology arms of the Helicobacter pylori futB gene
[0064] Inoculate the freeze-dried Helicobacter pylori 26695 strain into the Brucella broth plate for overnight culture in a microaerophilic e...
Embodiment 2
[0073] 1. ΔlpxE primer design and PCR amplification
[0074] According to the reported Helicobacter pylori 26695 strain sequence (GCA_000008525.1 with reference to the GenBank sequence number), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the lpxE gene respectively, and the amplified fragment sizes were 600bp and 500bp, the above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:
[0075] lpxE left-up: 5'GCTGCAGC GGCGTGATGAAATCCTACAAC 3'
[0076] lpxE left-down: 5’CGGAATTCCG cgctaatgaaatagaaagcaacgg 3’
[0077] lpxE right-up: 5'CGGGATCCCG taacgcctatgacaacacc 3'
[0078] lpxE right-down: 5'CCATCGATGG cctaccgcatctctttggatg 3'.
[0079] 2. Amplification of the upper and lower homology arms of the Helicobacter pylori lpxE gene
[0080] Inoculate the freeze-dried Helicobacter pylori 26695 strain into the Brucella broth plate for overnight culture in a microaero...
Embodiment 3
[0089] 1. ΔlpxF primer design and PCR amplification
[0090] According to the reported Helicobacter pylori 26695 strain sequence (GCA_000008525.1 with reference to the GenBank sequence number), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the lpxE gene respectively, and the amplified fragment sizes were 700bp and 600bp, the above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:
[0091] lpxF left-up: 5'GCTGCAGC ttaaagcatgagatgaccgctg 3'
[0092] lpxF left-down: 5’CGGAATTCCGgtttgaagcgagaactcataaccc’
[0093] lpxF right-up: 5'CGGGATCCCG gtctaatttagcgatcgcttcac 3'
[0094] lpxF right-down: 5'CCATCGATGG cgcatttttctaggatcgtgtc 3'.
[0095] 2. Amplification of the upper and lower homology arms of the Helicobacter pylori lpxF gene
[0096] Inoculate the freeze-dried Helicobacter pylori 26695 strain into the Brucella broth plate for overnight culture in a microa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com