Unlock instant, AI-driven research and patent intelligence for your innovation.

A barcode identification primer, identification method and kit for different species within Aeromonas

An identification method, the technology of Aeromonas, applied in the field of biology, can solve the problems of inability to accurately identify species

Active Publication Date: 2022-07-22
UNIV OF ELECTRONICS SCI & TECH OF CHINA ZHONGSHAN INST +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The difference between the 16SrRNA genes of different species of Aeromonas is low, only 0.06% to 0.66%. According to the commonly used standard, if the sequence similarity reaches more than 97%, it is regarded as the same level. However, using 16SrRNA sequence for analysis may cause The similarity with two or more species is greater than 97%, which leads to the inability to accurately identify the species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A barcode identification primer, identification method and kit for different species within Aeromonas
  • A barcode identification primer, identification method and kit for different species within Aeromonas
  • A barcode identification primer, identification method and kit for different species within Aeromonas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1.1 Design and synthesis of primers

[0023] Taking the cpn60 gene sequence of Aeromonas vermicularis in Genbank (accession number EU306841.1) as the target gene, the primers were designed by DNAStar-Lasergene software. The primers were synthesized by Yingweijieji (Shanghai) Trading Co., Ltd. See the primer information. Table 1.

[0024] Table 1 Specific primer sequences of cpn60 gene

[0025]

[0026] 1.2 Activation of strains and extraction of genomes

[0027] 1.2.1 Methods

[0028] (1) Activation of strains: Take out the preserved glycerol bacteria from the ultra-low temperature refrigerator, and inoculate 50 μl of bacterial liquid with a pipette at a ratio of 1:200 in a sterile environment in 10 ml of LB liquid medium at 37°C. , 140rpm shaking culture overnight.

[0029] (2) Collection of bacteria: Take 1ml of culture into a 1.5ml Ep tube, centrifuge at 8000rpm for 5min at room temperature, discard the supernatant, refill the culture into an Ep tube, repeat t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses barcode identification primers, identification methods and kits of different species within the genus Aeromonas. It includes F: 5’‑GGAATTCGCAACCGTTCTGGCTCAGGCTATCGT‑3’; R: 5’‑TGTCGACGACGGCAGCCACTTTCAC‑3’. 16S rRNA sequence analysis and identification methods generally believe that the sequence similarity of more than 97% is regarded as the same level, but in practical applications, multiple different species of Aeromonas often meet the sequence similarity requirements. In this case, 16S rRNA sequence analysis can only identify the genus level and cannot accurately identify the species. The invention can solve the above problems. After the cpn60 sequences of the species to be tested are compared by BLAST, the comparison results satisfying the similarity greater than 98.8% and the coverage greater than 98% are highly specific, and are a specific species of the genus Aeromonas. There are no cases of different species present in the results.

Description

Technical field: [0001] The invention belongs to the technical field of biology, and in particular relates to barcode identification primers, identification methods and kits of different species within the genus Aeromonas. Background technique: [0002] Aeromonas spp, belonging to the Vibrio family, is a facultative anaerobic, Gram-negative bacterium, widely distributed in aquatic habitats such as rivers, lakes, ponds, seawater, and estuaries. Aeromonas can infect a variety of animals, causing disease and even death of animals, posing huge challenges to the aquaculture industry. In addition, pathogenic Aeromonas can also cause acute diarrhea, bacteremia, meningitis, endocarditis and other diseases, which brings hidden dangers to public health safety and affects human health. Therefore, how to quickly and accurately identify pathogenic bacteria, so as to control the disease in a targeted manner, is of great significance in production practice. [0003] At present, the detec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/6869C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6869C12Q2531/113C12Q2565/125C12Q2537/165
Inventor 李梅许承佳李丹林森馨陈发明李天宇杨呈勇刘贻尧吴国锋潘育方
Owner UNIV OF ELECTRONICS SCI & TECH OF CHINA ZHONGSHAN INST