Cell line for targeted knockout of pig GDPD2 gene based on CRISPR-Cas9 technology, and construction method of cell line

A cell line, IPEC-J2 technology, applied in the field of gene knockout model construction of porcine small intestinal epithelial cell line, can solve the problem that there is no small intestinal epithelial cell model

Pending Publication Date: 2020-12-01
YANGZHOU UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no relevant research reports on the knockout vector of porcine GDPD2 gene and small intestinal epithelial cell model of GDPD2 gene knockout

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell line for targeted knockout of pig GDPD2 gene based on CRISPR-Cas9 technology, and construction method of cell line
  • Cell line for targeted knockout of pig GDPD2 gene based on CRISPR-Cas9 technology, and construction method of cell line
  • Cell line for targeted knockout of pig GDPD2 gene based on CRISPR-Cas9 technology, and construction method of cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] 1. Target site design and sgRNA sequence synthesis

[0063] Find the CDS region of GDPD2 (Gene ID: 100516309) according to the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and design the knockout target site according to the first exon where the CDS region is located. Use CRISPRDesign (http: / / crispr.mit.edu / ) to design three sgRNA guide sequences:

[0064] sgRNA1: CTCACCATGGCCGAGTCCCGCGG

[0065] sgRNA2: CCAACAAGGTGAAGTATGGGTGG

[0066] sgRNA3: ACTGTCTGTATAGCTGCCACTGG

[0067] Add CACC at the 5' end of the sgRNA guide sequence and remove the PAM (NGG) sequence at the 3' end. If the first base at the 5' end of the sgRNA guide sequence is not G, add CACCG to form a positive-strand sgRNA sequence; the reverse of the sgRNA guide sequence The base AAAC is added to the 5' end of the complementary sequence to form a negative-strand sgRNA sequence. The three pairs of positive and negative strand sgRNA sequences are as follows:

[0068] GDPD2-1F: CACCGCTCACCATGGCCGAGTCCCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cell line for the targeted knockout of a pig GDPD2 gene based on the CRISPR-Cas9 technology, and a construction method of the cell line. The cell line is prepared by the following steps: (1) designing an sgRNA guide sequence according to the pig GDPD2 gene; (2) annealing a positive strand sgRNA sequence and a negative strand sgRNA sequence to form double-stranded DNA, andconnecting the double-stranded DNA with a linearization pGK1.1 vector to obtain a positive targeting vector; and (3) performing mixed electrotransfection on the positive targeting vector and target cells IPEC-J2 to obtain GDPD2 gene knockout IPEC-J2 cells. The CRISPR / Cas9 technology is used for establishing the pig GDPD2 gene knockout IPEC-J2 cell line for the first time, and the research on theprotein function of GDPD2 is facilitated. The CRISPR / Cas9 knockout technology is simple in method, the target gene can be efficiently knocked out by designing sgRNA to cause that the function of the GDPD2 gene is lost, and thereby the pig GDPD2 gene knockout IPEC-J2 cell line is an ideal GDPD2 gene knockout IPEC-J2 cell model.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to the construction of a porcine GDPD2 gene knockout cell line using CRISPR / Cas9 technology, and also relates to the construction technology of a pig small intestinal epithelial cell line (IPEC-J2) gene knockout model. Background technique [0002] The CRISPR / Cas9 system is an adaptive immune defense system formed during the long-term development of archaea and bacteria. As a system of regularly clustered interspaced short palindromic repeats, CRISPR / Cas9 is a gene editing tool. Cas9 nuclease-mediated sgRNA recognizes and cleaves dsDNA, and induces frameshift mutations caused by non-homologous end-joining repair mechanisms, thereby realizing Editing of target genes. Due to the strong operability and high efficiency of this technology, it has become an important genetic means of fixed-point editing in recent years, and it is one of the most promising gene therapy technolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/85C12N5/071A01K67/027
CPCC12N15/1137C12N15/8509C12N9/16C12N5/0679C12N5/0625A01K67/0276C12Y301/04046C12N2310/20A01K2207/15A01K2217/075A01K2227/108A01K2267/03
Inventor王海飞周雅静包文斌范海瑞吴圣龙
OwnerYANGZHOU UNIV