Check patentability & draft patents in minutes with Patsnap Eureka AI!

Plant expression carrier with dual insect-resisting genes and its application

A plant and gene technology, applied in the field of Bt gene, can solve problems that have not been well solved

Inactive Publication Date: 2003-09-10
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, the above problems have not been well resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression carrier with dual insect-resisting genes and its application
  • Plant expression carrier with dual insect-resisting genes and its application
  • Plant expression carrier with dual insect-resisting genes and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0152] Example 2 Insect-resistant transgenic plants 1. Transformation of tobacco

[0153] The leaves of the aseptically cultured tobacco NC89 were used to transfer the above-constructed pBS29K, pBBA, T- A batch of kanamycin-resistant insect-resistant transgenic tobacco plants were obtained by transferring DNA (including NPTII gene and corresponding insect-resistant gene) into tobacco chromosomes. 2. Analysis of transformed and regenerated tobacco plants 2.1 PCR detection of transformed and regenerated plants

[0154] Tobacco DNA extraction and PCR detection of transgenic tobacco were carried out according to the method described by Li Taiyuan et al. (Chinese Science B Series 24: 276-282, 1994), and the Cry1Ac gene-specific primers were:

[0155] PIIm + 5′ATCTATGCAGAGTCTTTCAGA

[0156] PLV-6 - 5′GAGGTTATTCCAAGGAGGT

[0157] The product obtained by PCR with these two primers should be 1370bP. API-BA gene-specific primers are: B 1 : GGATCCACCATGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An artificially synthesized fusion protein gene BtS29K is disclosed, which along the with fusion protease inhibitor gene AP1-BA is used to configure the expression carrier pBS29K-BA of the plant with dual-insect-resisting gene. The said carrier can be used to obtain high-insecticiding transgenic plant, which features broad spectrum, high insecticiding power and delaying the generation of insect resistance.

Description

technical field [0001] The invention belongs to the field of plant insect-resistant genetic engineering, and relates to chemically synthesizing a gene fragment encoding a fully activated insecticidal protein in the Bacillus thuringiensis (Bt) crystal protein Cry1Ac gene, hereinafter referred to as the Bt gene; at the end of the Bt gene, add A signal peptide coding sequence synthesized on [1] and a polypeptide coding sequence with endoplasmic reticulum localization function [2] And form the chimeric gene BtS29K, this structure is conducive to improving the stability of Bt insecticidal protein, and is also conducive to constructing a double anti-insect gene expression vector together with the protease inhibitor gene; using DNA recombination technology to inhibit the chimeric gene and saguinase The fusion gene of the agent is constructed into the plant expression vector of the double insect resistance gene. These vectors are used to obtain high-efficiency insect-resistant trans...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N63/00C12N1/21C12N15/12C12N15/15C12N15/32C12N15/57C12N15/62C12N15/63C12N15/82
CPCY02A40/146
Inventor 田颖川郭洪年秦红敏芦睿李常青
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com