Preparation method and application of pancreatic cancer animal model based on gene knockout Syrian hamster
A Syrian hamster, gene knockout technology, applied in the directions of botanical equipment and methods, biochemical equipment and methods, and other methods of inserting foreign genetic materials, which can solve the problems of lymphopenia, damage to lymphatic development, reduction, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Example 1 Establishment and Identification of Immunodeficient Syrian Hamsters with il2rg Gene Knockout
[0075] 1. Design and prepare Cas9 mRNA and sgRNA
[0076]As a specific embodiment, in step (1), the Cas9 mRNA was purified by the MinElute PCR Purification Kit according to the instructions to recover the linearized T7 promoter vector plasmid, and then the MEGAshort Kit was used to transcribe in vitro according to the instructions; the design target of the sgRNA was il2rg A site-specific sequence within the first exon of the gene (NW_004801714.1). The sgRNA sequence was designed using the online software Benchling (https: / / benchling.com / ), and its predicted on-target efficiency and off-target efficiency were predicted. The sequence used in this experiment example is: GAGCAGCTGAAGGAGTAAGA;
[0077] 2. Microinjection and Embryo Transfer
[0078] Using mineral oil-coated HECM-9 medium as the injection medium, Cas9 mRNA (100 ng / μL) and sgRNA (50ng / μL) were injected in...
Embodiment 2
[0089] Example 2 Establishment of pancreatic cancer model based on knockout of il2rg gene in Syrian hamster
[0090] 1. At the age of 5 weeks, male, il2rg knockout Syrian hamsters were subcutaneously injected with 5×106 MIA-PaCa2 or other cells on the upper right side. Tumor size was measured twice a week using calipers until the tumor reached 3,500 mm3 or tumor ulceration occurred. Tumor volume (V) was calculated using the formula V=(length×width2×π) / 6).
[0091] 2. As a specific embodiment, in step (2), anesthetize il2rg gene knockout Syrian hamsters with 1.2% Avertin solution (45 mg / kg) and expose the pancreas, and suspend 1×106 using basement membrane matrigel For MIA-PaCa2 cells, the cell suspension was injected vertically into the tail of the pancreas using a 29-gauge needle. The pancreas was put back in place and the abdominal cavity was closed. After 10 weeks, the above hamsters were killed with CO2. If hamsters develop ascites, jaundice, cachexia, or both that are a...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com