A method and application of using Ulmus ulmi tissue to prepare plant hybrid breeding adhesive
A technology of hybrid breeding and adhesives, applied in the direction of botany equipment and methods, applications, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1 Preparation and verification of the plant cross-breeding adhesive containing Ulmus ulmus tissue
[0047] Weigh 0.1g of the mixed tissue of fresh elm leaves and young stems, put it into a mortar, add 1ml of phosphate buffer (pH7.2), grind it into a slurry in an ice bath, pour it into a 1.5ml centrifuge tube, 10000r / min , centrifuge at 4°C for 6 min. After centrifugation, there are three layers of substances in the centrifuge tube. After discarding the upper layer of green water quality liquid, use a pipette to slowly absorb the slightly yellow viscous substance in the middle to obtain the adhesive, and verify it. The forward primer is TATAATGAATTGCGTGTAGCCC, and the reverse primer is CATAGCAGGAGTGTTGAAGGTC. Add the components according to the ratio in the PCR system in Table 1, and then dispense the system into 20 μL per well of the PCR plate. Pre-denature at 95°C for 10 minutes; denature at 95°C 50s, annealing at 55°C for 50s, extension at 72°C for 60s, cy...
experiment example 1
[0051] Application of Experimental Example 1 Adhesive in Elm and Beech
[0052]5 days before the pollination, use 75% ethanol to inactivate the pollen of Ulmus ulman, and after natural drying, mix it with the pollen of beech in a volume ratio of 1:3 to obtain 1ml of mixed pollen, and divide the mixed pollen evenly into 2 tubes, 0.5ml mixed pollen in each tube, and number 1 tube and 2 tubes. Add 0.25 ml of the adhesive of Example 1 to 1 tube of mixed pollen, and mix it evenly with a vortex shaker to prepare mixed liquid pollen for use. The mixed pollen of 2 tubes was added with equal volume of clear water to make liquid pollen as a control. When the pollination of Ulmus ultifolia is performed, 1 tube and 2 tubes of mixed liquid pollen are respectively applied to the stigma of Ulmus ulmus, and 10 inflorescences of Ulmus ulman are applied respectively. As a result, it was found that 10 inflorescences of Ulmus chinensis smeared with 1 tube produced fruit and 14 seeds were obtain...
experiment example 2
[0053] Experimental Example 2 Application of Adhesive in Qingtan and Ulmus sinensis
[0054] 5 days before pollination, use 80% ethanol to inactivate the pollen of Qingtan, and after natural drying, mix it with the pollen of Ulmus sinensis in a volume ratio of 1:4 to obtain 1ml of mixed pollen, and divide the mixed pollen evenly into 2 tubes, 0.5ml each, numbered 3 tubes and 4 tubes. Add 0.5 ml of the adhesive of Example 1 to the mixed pollen of 3 tubes, and mix it with a vortex shaker to prepare mixed liquid pollen for use. The mixed pollen of 4 tubes was added with equal volume of clear water to make liquid pollen as a control.
[0055] When the green sandalwood is pollinated, respectively dip 3 tubes and 4 tubes of mixed liquid pollen and apply it on the stigma of the green sandalwood, and apply 10 inflorescences of the green sandalwood respectively. As a result, it was found that the 10 inflorescences of smeared with 3 tubes were fruity and 3 seeds were obtained, while t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More