Non-human mammal model as well as construction method and application thereof
A technology for non-human mammals and construction methods, applied in biochemical equipment and methods, other methods for inserting foreign genetic materials, using vectors to introduce foreign genetic materials, etc., can solve the problems of time-consuming, low detection efficiency, time-consuming and labor-intensive problems Money and other issues, to achieve the effect of simple implementation, improved detection efficiency, and accurate response
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Such as figure 1 As shown, it is the construction strategy diagram of the mouse model knocked in with AR-lcuiferase in this example. Using CRISPR / Cas9 technology, through homologous recombination, the expression of 2A-Luc is knocked in at the stop codon site of the AR gene. frame. The gRNA used therein is only effective against the AR sequence.
[0070] The main steps are as follows:
[0071] 1. According to the purpose of knocking in the 2A-Luc expression box at the stop codon site of the AR gene, design a guide RNA (guide RNA, gRNA).
[0072] SEQ ID NO.1:
[0073] ATTGCAAGAGAGCTGCATCAGTTCACTTTTGACCTGCTAATCAAGTCCCATATGGTGAGCGTGGACTTTCCTGAAATGATGGCAGAGATCATCTCTGTGCAAGTGCCCAAGATCCTTTCTGGGAAAGTCAAGCCCATCTATTTCCACACACAGTGAAGATTTGGAAACCCTAATACCCAAAACCCACCTTGTTCCCTTTCCAGATGTCTTCTGCCTGTTATATAACTCTGCACTACTTCTCTGCAGTGCCTTGGGGGAAATTCCTCTACTGATGTACAGTCTGTCGTGA
[0074] The gRNA sequence information used in this example is SEQ ID NO.2-3.
[0075] SEQ ID NO.2: gRNA1:5'-TTCCAA...
Embodiment 2
[0108] The detection of each tissue luciferase signal of the mouse model of knocking in the androgen receptor-luciferase of embodiment 1 comprises the following steps:
[0109] 1) Take a knock-in mouse with androgen receptor-luciferase obtained in Example 1, kill it by neck dislocation, and separate each tissue;
[0110] 2) Aliquot 20 mg of each tissue into a 1.5 mL centrifuge tube, add 200 uL luciferase signal detection buffer (150 mM KCl, 20 mM HEPES, 5 mM MgCl 2 , 1 mM EGTA. NaOH to adjust the pH to 7.0), and grind the tissue into a homogenate;
[0111] 3) Centrifuge at a low temperature of 4°C and 13kpm for 20 minutes;
[0112] 4) Take 15uL of supernatant, 15uL and 30μL of high-sugar DMEM medium Reagent ( Luciferase Assay System, Promega) were mixed into the wells of the CulturPlate™-96 white solid bottom 96-well plate (PerkinElmer);
[0113] 5) Shake for 10 minutes;
[0114] 6) Measure on a fluorescent light meter (the luciferase reacts with the substrate to flash...
Embodiment 3
[0117] The mouse model of androgen receptor-luciferase knocked in to embodiment 1 is detected in embryonic fibroblast (MEF) cell luciferase signal under drug stimulation, comprising the following steps:
[0118] 1. Isolation and culture of mouse embryonic fibroblast (MEF) cells
[0119] 1) Get a 12.5-14.5-day pregnant female mouse knocked in with androgen receptor-luciferase obtained in Example 1, kill it by neck breaking, soak it in 75% alcohol for 5 minutes, and then transfer it to the operating table , exposing the uterus under sterile conditions;
[0120] 2) Take out the whole uterus, place it in a plate with PBS, and wash it three times with PBS;
[0121] 3) Cut the uterus along the side of the mesentery, take out the embryos with the fetal membranes, place them in another plate filled with PBS, and wash them thoroughly;
[0122] 4) Tear the fetal membranes with tweezers, take out the peptide mouse, wash three times with PBS, take out the head, viscera and limbs of the ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com