Unlock instant, AI-driven research and patent intelligence for your innovation.

Non-human mammal model as well as construction method and application thereof

A technology for non-human mammals and construction methods, applied in biochemical equipment and methods, other methods for inserting foreign genetic materials, using vectors to introduce foreign genetic materials, etc., can solve the problems of time-consuming, low detection efficiency, time-consuming and labor-intensive problems Money and other issues, to achieve the effect of simple implementation, improved detection efficiency, and accurate response

Inactive Publication Date: 2020-12-25
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI +1
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, for the screening of drugs that regulate the changes in AR expression, especially the changes in AR protein levels, it is time-consuming, labor-intensive and costly to use real-time quantitative RT-PCR or western blot methods for drug screening.
Real-time quantitative PCR needs at least one day to detect changes in AR, while western blot needs at least two days to detect and analyze, which takes a long time and has low detection efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-human mammal model as well as construction method and application thereof
  • Non-human mammal model as well as construction method and application thereof
  • Non-human mammal model as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Such as figure 1 As shown, it is the construction strategy diagram of the mouse model knocked in with AR-lcuiferase in this example. Using CRISPR / Cas9 technology, through homologous recombination, the expression of 2A-Luc is knocked in at the stop codon site of the AR gene. frame. The gRNA used therein is only effective against the AR sequence.

[0070] The main steps are as follows:

[0071] 1. According to the purpose of knocking in the 2A-Luc expression box at the stop codon site of the AR gene, design a guide RNA (guide RNA, gRNA).

[0072] SEQ ID NO.1:

[0073] ATTGCAAGAGAGCTGCATCAGTTCACTTTTGACCTGCTAATCAAGTCCCATATGGTGAGCGTGGACTTTCCTGAAATGATGGCAGAGATCATCTCTGTGCAAGTGCCCAAGATCCTTTCTGGGAAAGTCAAGCCCATCTATTTCCACACACAGTGAAGATTTGGAAACCCTAATACCCAAAACCCACCTTGTTCCCTTTCCAGATGTCTTCTGCCTGTTATATAACTCTGCACTACTTCTCTGCAGTGCCTTGGGGGAAATTCCTCTACTGATGTACAGTCTGTCGTGA

[0074] The gRNA sequence information used in this example is SEQ ID NO.2-3.

[0075] SEQ ID NO.2: gRNA1:5'-TTCCAA...

Embodiment 2

[0108] The detection of each tissue luciferase signal of the mouse model of knocking in the androgen receptor-luciferase of embodiment 1 comprises the following steps:

[0109] 1) Take a knock-in mouse with androgen receptor-luciferase obtained in Example 1, kill it by neck dislocation, and separate each tissue;

[0110] 2) Aliquot 20 mg of each tissue into a 1.5 mL centrifuge tube, add 200 uL luciferase signal detection buffer (150 mM KCl, 20 mM HEPES, 5 mM MgCl 2 , 1 mM EGTA. NaOH to adjust the pH to 7.0), and grind the tissue into a homogenate;

[0111] 3) Centrifuge at a low temperature of 4°C and 13kpm for 20 minutes;

[0112] 4) Take 15uL of supernatant, 15uL and 30μL of high-sugar DMEM medium Reagent ( Luciferase Assay System, Promega) were mixed into the wells of the CulturPlate™-96 white solid bottom 96-well plate (PerkinElmer);

[0113] 5) Shake for 10 minutes;

[0114] 6) Measure on a fluorescent light meter (the luciferase reacts with the substrate to flash...

Embodiment 3

[0117] The mouse model of androgen receptor-luciferase knocked in to embodiment 1 is detected in embryonic fibroblast (MEF) cell luciferase signal under drug stimulation, comprising the following steps:

[0118] 1. Isolation and culture of mouse embryonic fibroblast (MEF) cells

[0119] 1) Get a 12.5-14.5-day pregnant female mouse knocked in with androgen receptor-luciferase obtained in Example 1, kill it by neck breaking, soak it in 75% alcohol for 5 minutes, and then transfer it to the operating table , exposing the uterus under sterile conditions;

[0120] 2) Take out the whole uterus, place it in a plate with PBS, and wash it three times with PBS;

[0121] 3) Cut the uterus along the side of the mesentery, take out the embryos with the fetal membranes, place them in another plate filled with PBS, and wash them thoroughly;

[0122] 4) Tear the fetal membranes with tweezers, take out the peptide mouse, wash three times with PBS, take out the head, viscera and limbs of the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a non-human mammal model knocked with an androgen receptor luciferase gene as well as a construction method and application of the non-human mammal model. The constructed non-human mammal model knocked with the androgen receptor luciferase can be used as a screening platform of drugs for treating castration-resistant prostate cancer, polycystic ovarian syndrome and other diseases related to androgen receptor abnormal expression, drugs for regulating androgen receptor gene expression can be simply, rapidly and massively screened; and on the premise of not injuring non-human mammals, the expression and distribution of androgen receptors can be directly detected in vivo by using a fluorescence imager.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a non-human mammal model and its construction method and application. Background technique [0002] As a steroid hormone that controls male development and adult male phenotype and maintains reproductive function, androgen has important physiological significance, and its physiological function is mainly through binding with androgen receptor (AR), thereby activating androgen The transcriptional activity of receptors regulates the expression of downstream genes. In the absence of androgen receptors, androgens have no stimulatory response to tissues. [0003] Androgen receptor (AR), one of the steroid hormone receptors, also belongs to the nuclear receptor superfamily. It generally consists of four domains: N-terminal transcription activation domain (NTD), DNA binding domain (DBD), hinge domain and ligand binding domain (LBD). [0004] Current studies indicate that androgen recepto...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/90C12N9/22A01K67/027
CPCC12N15/85C12N15/907C12N9/22A01K67/0275A01K2217/072A01K2267/03A01K2267/0331
Inventor 许永吴东海聂涛赵雪梅赵世亭惠晓艳
Owner GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI