Moncrotophos nucleic acid aptamer, aptamer derivative and application thereof
A nucleic acid aptamer and monocrotophos nucleic acid technology, which is applied in biological testing, biochemical equipment and methods, fluorescence/phosphorescence, etc., can solve expensive problems and achieve high affinity, convenient use, and good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Selection of detection conditions based on nucleic acid aptamers:
[0032] 1. Selection of F-J-SS15 and QB addition ratio:
[0033] Add 26 μL of 0.1 μmol / L F-J-SS15 (1×SB buffer system) to each centrifuge tube, and then in the control group CK 0 Add 26μL 1×SB buffer solution in the control group CK 1 26 μL of 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, 0.25 μmol / L, 0.3 μmol / L of QB (1×SB buffer system) was added to the pesticide group, that is, the ratio of F-J-SS15 to QB was 1 : 1, 1:1.5, 1:2, 1:2.5, 1:3.
[0034] Shake well, centrifuge, and then incubate at 25°C in the dark for 20 minutes; then add 52 μL of 1×SB buffer solution to the two groups of control groups, and add 52 μL of 1 mmol / L monocrotophos to the other centrifuge tubes, which is the final concentration of F-J-SS15 in the system The final concentration of monocrotophos was 0.025μmol / L, and the final concentration of monocrotophos was 0.5mmol / L; shake and shake immediately, after centrifugation, take 100μL fro...
Embodiment 2
[0046] According to the relevant data of above-mentioned embodiment 1, monocrotophos standard curve is established:
[0047] (1) Select the monocrotophos nucleic acid aptamer as F-J-SS15 and the complementary sequence as QB, use 1×SB buffer system to configure the concentration of F-J-SS15 to be 0.025 μmol / L, and the concentration of QB to be 0.05 μmol / L. They were mixed and incubated at a constant temperature of 25°C for 30 minutes in a light-proof environment, and the hybridization product was obtained for use; wherein F-J-SS15 is a single-stranded DNA that recognizes monocrotophos with the 5'-terminal labeling fluorescent group FAM, and the sequence is: 5'-FAM- CCGCTGAAGCTCCGGCTGCAGCGATTCAAGACGATTCGAACGAGTCGCTCTTG-3′, QB is a single-stranded DNA labeled with DABCYL at the 3′ end, and the sequence is: 5′-GAGCTTCAGC-DABCYL-3′;
[0048] (2) Using 1×SB buffer system to configure monocrotophos at a standard concentration as a standard group, add it to the above-mentioned hybridi...
Embodiment 3
[0052] Sample testing:
[0053] The artificial lake water was collected, filtered through a 0.22 μm filter membrane, and prepared as water samples containing 50 μmol / L, 300 μmol / L, and 500 μmol / L monocrotophos (1×SB buffer system) for future use.
[0054] According to the detection process, the blank spike recovery experiment was carried out, so that the final concentration of F-J-SS15 in the system was 0.025 μmol / L, the final concentration of QB was 0.05 μmol / L, and the final concentration of monocrotophos were 25 μmol / L and 150 μmol / L respectively. L, 250 μmol / L, after shaking and centrifuging, place it in the dark for 60 minutes, and then take 100 μL of the solution to measure the fluorescence value. Calculate the concentration calculation recovery rate of pesticide according to formula and standard curve linear equation:
[0055]
[0056] In the formula: P is the recovery rate, C 1 is the final concentration of pesticides measured in the spiked group; C 2 is the actu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap