Unlock instant, AI-driven research and patent intelligence for your innovation.

Moncrotophos nucleic acid aptamer, aptamer derivative and application thereof

A nucleic acid aptamer and monocrotophos nucleic acid technology, which is applied in biological testing, biochemical equipment and methods, fluorescence/phosphorescence, etc., can solve expensive problems and achieve high affinity, convenient use, and good stability

Active Publication Date: 2021-01-05
GUANGDONG UNIV OF PETROCHEMICAL TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are many detection methods for pesticide residues, including rapid detection methods such as chromatography, spectroscopy, enzyme inhibition, and immunoassay. Although these methods are accurate in quantification and high in sensitivity, they require expensive instruments and professional personnel to operate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Moncrotophos nucleic acid aptamer, aptamer derivative and application thereof
  • Moncrotophos nucleic acid aptamer, aptamer derivative and application thereof
  • Moncrotophos nucleic acid aptamer, aptamer derivative and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Selection of detection conditions based on nucleic acid aptamers:

[0032] 1. Selection of F-J-SS15 and QB addition ratio:

[0033] Add 26 μL of 0.1 μmol / L F-J-SS15 (1×SB buffer system) to each centrifuge tube, and then in the control group CK 0 Add 26μL 1×SB buffer solution in the control group CK 1 26 μL of 0.1 μmol / L, 0.15 μmol / L, 0.2 μmol / L, 0.25 μmol / L, 0.3 μmol / L of QB (1×SB buffer system) was added to the pesticide group, that is, the ratio of F-J-SS15 to QB was 1 : 1, 1:1.5, 1:2, 1:2.5, 1:3.

[0034] Shake well, centrifuge, and then incubate at 25°C in the dark for 20 minutes; then add 52 μL of 1×SB buffer solution to the two groups of control groups, and add 52 μL of 1 mmol / L monocrotophos to the other centrifuge tubes, which is the final concentration of F-J-SS15 in the system The final concentration of monocrotophos was 0.025μmol / L, and the final concentration of monocrotophos was 0.5mmol / L; shake and shake immediately, after centrifugation, take 100μL fro...

Embodiment 2

[0046] According to the relevant data of above-mentioned embodiment 1, monocrotophos standard curve is established:

[0047] (1) Select the monocrotophos nucleic acid aptamer as F-J-SS15 and the complementary sequence as QB, use 1×SB buffer system to configure the concentration of F-J-SS15 to be 0.025 μmol / L, and the concentration of QB to be 0.05 μmol / L. They were mixed and incubated at a constant temperature of 25°C for 30 minutes in a light-proof environment, and the hybridization product was obtained for use; wherein F-J-SS15 is a single-stranded DNA that recognizes monocrotophos with the 5'-terminal labeling fluorescent group FAM, and the sequence is: 5'-FAM- CCGCTGAAGCTCCGGCTGCAGCGATTCAAGACGATTCGAACGAGTCGCTCTTG-3′, QB is a single-stranded DNA labeled with DABCYL at the 3′ end, and the sequence is: 5′-GAGCTTCAGC-DABCYL-3′;

[0048] (2) Using 1×SB buffer system to configure monocrotophos at a standard concentration as a standard group, add it to the above-mentioned hybridi...

Embodiment 3

[0052] Sample testing:

[0053] The artificial lake water was collected, filtered through a 0.22 μm filter membrane, and prepared as water samples containing 50 μmol / L, 300 μmol / L, and 500 μmol / L monocrotophos (1×SB buffer system) for future use.

[0054] According to the detection process, the blank spike recovery experiment was carried out, so that the final concentration of F-J-SS15 in the system was 0.025 μmol / L, the final concentration of QB was 0.05 μmol / L, and the final concentration of monocrotophos were 25 μmol / L and 150 μmol / L respectively. L, 250 μmol / L, after shaking and centrifuging, place it in the dark for 60 minutes, and then take 100 μL of the solution to measure the fluorescence value. Calculate the concentration calculation recovery rate of pesticide according to formula and standard curve linear equation:

[0055]

[0056] In the formula: P is the recovery rate, C 1 is the final concentration of pesticides measured in the spiked group; C 2 is the actu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a monocrotophos nucleic acid aptamer, an aptamer derivative and application thereof, and relates to the technical field of aptamers. The nucleotide sequence of the monocrotophosnucleic acid aptamer is CCGCTGAAGCTCCGGCTGCAGCGATTCAAGACGATTCGAACGAGTCGCTCTTG. The 5' tail end of the monocrotophos nucleic acid aptamer is marked with a fluorophore, a sequence complementarily hybridized with the monocrotophos nucleic acid aptamer is designed, a quenching group is marked at the 3' tail end of the monocrotophos nucleic acid aptamer, and when the monocrotophos nucleic acid aptameris hybridized with a complementary sequence, a fluorescence signal is very weak; when the moncrotophos recognizes and binds to nucleic acid aptamer, the aptamer structure conversion causes complementary sequence dissociation to enhance the fluorescence signal, the change of the fluorescence signal can be utilized to establish a standard curve, and the monocrotophos aptamer screened by an SELEX technique has the advantages of favorable specificity, high affinity, high stability, convenient use and the like, and can be used for monocrotophos detection and analysis.

Description

technical field [0001] The invention relates to the technical field of nucleic acid aptamers, in particular to a monocrotophos nucleic acid aptamer, aptamer derivatives and applications thereof. Background technique [0002] Monocrotophos is a highly efficient systemic organophosphate insecticide with strong contact and stomach toxicity. Wide insecticidal spectrum, good quick-acting, long residual period, effective against a variety of chewing and moth-eating pests. It has a good control effect on pests on cotton, rice, corn, sugarcane and other crops. At present, there are many detection methods for pesticide residues, including rapid detection methods such as chromatography, spectroscopy, enzyme inhibition, and immunoassay. Although these methods are accurate in quantification and high in sensitivity, they require expensive instruments and professional personnel to operate. Therefore, it is necessary to develop a new detection method for monocrotophos. [0003] Nucleic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N21/64G01N33/53
CPCC12N15/115G01N33/53G01N21/6428C12N2310/16G01N2021/6432G01N33/184Y02A50/30
Inventor 王丽迟恩忠张强赵新淮
Owner GUANGDONG UNIV OF PETROCHEMICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More