35results about How to "Realize detection and analysis" patented technology

The invention discloses an in-situ integrated multi-spectrum measurement system and method. The system comprises an in-situ integrated multi-spectrum induction excitation unit, at least one light source and excitation light focusing unit, at least three spectrum signal detection units, at least one annular track and radial radiation arms matched with the annular track, wherein each arm slides along the track around the corresponding center axle of the annular track, the total number of the radial radiation arms is at least four. The in-situ integrated multi-spectrum induction excitation unit is a surface plasma resonance coupling element and arranged in the center area of the first annular track. The intersecting line of a non-sample contact surface of a surface plasma resonance sensing film and a central symmetrical surface of a surface plasma resonance coupling prism is coincident with the center axle of the first annular track. The light source, the excitation light focusing unit, and the spectrum signal detection units are respectively fixed on the respective radial radiation arms.

The invention relates to a method for detecting organic pollutants by virtue of combination of solid phase micro-extraction and surface enhancement Raman. The method comprises the following steps: with a solid phase micro-extraction probe as a surface enhancement Raman active substrate, extracting for 3-10 hours in the to-be-detected environment under the stirring condition with the temperature of 20-30 DEG C, then putting the solid phase micro-extraction probe on a Raman detection platform, irradiating the solid phase micro-extraction probe by using laser to obtain Raman characteristic peaks of the to-be-detected organic pollutants, and analyzing the detected organic pollutants according to the Raman characteristic peaks. The method for detecting the organic pollutants is integrated with the advantages of the solid phase micro-extraction technology and the surface enhancement Raman technology; the organic pollutants in the environment can be quickly analyzed and detected; the sameness analysis of polyaromatic hydrocarbon can be realized; polyaromatic hydrocarbon mixtures can be detected and analyzed.

The invention relates to an asphalt pavement material recycling device and an asphalt pavement material recycling method. The asphalt pavement material recycling device is characterized by comprising a solvent storage tank, wherein the inlet of the solvent storage tank is connected with a condenser by a pipeline, the outlet of the solvent storage tank is connected with the inlet of a solvent tank by a pipeline, the outlet of the solvent tank is connected with the inlet of a solvent pump by a pipeline, the outlet of the solvent pump is connected with the inlets of two washing chambers and a flushing device arranged in a high-speed centrifugal machine by three parallel-connected pipelines respectively, the outlet pipelines of two washing chambers are connected with the inlet of the high-speed centrifugal machine, the outlet of the high-speed centrifugal machine is connected with the inlet of a solvent evaporating pot by a pipeline, the outlet of the solvent evaporating pot is connected with one inlet of a blending tank by a pipeline, the other outlet of the solvent evaporating pot and pipelines of steam outlets at the tops of the two washing chambers are converged by pipelines so as to be connected with the condenser, and the other inlet of the blending tank is connected with a fresh asphalt storage tank by a pipeline. According to the asphalt pavement material recycling device and the asphalt pavement material recycling method, aggregates and old asphalts in the old asphalt mixture can be screened and recycled, and besides, a secondary flushing device is arranged, so that the mixture can be effectively separated and filtered.

The invention discloses an inorganic nano composite catalyst with peroxidase property. The inorganic nano composite catalyst is characterized in that oxidized graphene and Fe3O4(at)MnO2 nano particles are mixed and are ultrasonically dispersed to obtain a composite nanosheet with the size being 40-70nm, wherein the concentration of the oxidized graphene is 1-4mg.mL<-1>, the concentration of Fe3O4(at)MnO2 is 2-8mg.mL<-1>, and the ratio of the concentration of the oxidized graphene to the concentration of Fe3O4(at)MnO2 is 1:2. The capacity of performing catalytic decomposition on TMB for the obtained composite catalyst is superior to that of the oxidized graphene or the Fe3O4(at)MnO2 nano particles, and the composite catalyst is wide in application range and can be applied to sewage treatment.

The invention discloses a porous array electromagnetic field reinforced SERS (surface enhanced raman scattering) device for detecting trace microcystic toxins and a preparation method of the porous array electromagnetic field reinforced SERS device. The device comprises a silicon dioxide substrate layer and a film layer which are adhered to each other, wherein a window is reserved in the silicon dioxide substrate layer to enable a part of the film layer to be exposed; a metal layer is adhered to the surface of the window and the exposed film layer; upper and lower through holes A and B which are distributed in an array manner are respectively formed in the exposed film layer and the metal layer on the exposed film layer; and the film layer is a silicon nitride film, a molybdenum disulfide film or a graphene film. The invention further discloses a method for detecting trace microcystic toxin molecules in a water environment by utilizing the SERS device. By adopting the method, detection of through hole weak current signals of the trace microcystic toxin molecules and enhancement of weak Raman scattering signals of the trace microcystic toxin molecules are achieved, and detection of the contents of trace molecules and detection of surface enhanced Raman scattering signals are achieved simultaneously.

The invention provides a method for qualitatively analyzing pollen volatile organic compounds by using a gaseous migration chromatographic analysis technology so as to identify pollen species and purity. Volatile gas of a pollen sample is subjected to ionization detection of a gaseous transfer chromatography, three-dimensional qualification is carried out according to retention index, migration rate and strength of quasi-molecular ions, and a spectrogram is drawn. By qualitative analysis on features of different pollen species special volatile organic compounds, a characteristic gaseous transfer chromatogram map is drawn, a big database is established, and therefore, a qualitative identifying method for pollen species and quantitative calculating method for purity of the pollen are realized. By the method, the identifying time is short, the degree of automation is high, stability and reliability are high, the accuracy is also high, detection flux is large, protein ingredients of inspected pollen are not damaged, and meanwhile, on the basis of a big data analyzing technology, the method can be used for aerobiology monitoring, and is used for broadcasting pollen concentration.

The invention discloses an analysis method of disaccharides containing uronic acid based on reductive amine derivatization. The analysis method comprises the following specific steps: extracting polysaccharides in animal tissue and collecting polysaccharides containing uronic acid; carrying out acid hydrolysis to obtain disaccharide products; adding a reduction amine reagent solution, preparing reduction amine derivatives of disaccharides of polysaccharides containing uronic acid, detecting by using a high performance liquid chromatography-multistage mass spectrometry, and indirectly achieving qualitative analysis on the polysaccharides containing uronic acid. The invention also provides a preparation method of the disaccharides containing uronic acid based on reductive amine derivatization. The method is suitable for analyzing and preparing disaccharides of two types of hexuronic acid-hexosamine and hexuronic acid-hexose; acid degradation is adopted; compare with enzymatic degradation, acid hydrolyzation is low in cost and simple to operate, and has degradation effects on various polysaccharides; ammonium hydroxide is used for replacing common NaOH; ammonium hydroxide is volatilizable, is easy to remove, and can facilitate the mass spectrometry analysis in the later period.

The embodiment of the invention discloses an image processing method and device based on anchor point image cutting, equipment and a medium, and the method comprises the steps: obtaining the anchor point information of an image based on the annotation information of the image; wherein the anchor point information may include center point information and size information of the anchor point identification frame. The size information of the sliding window can be accurately determined according to the set maximum value of the sliding window, the minimum value of the sliding window, the size multiple and the size information of the anchor point identification frame; and on the basis of the sliding window size information and the center point information, a cut image containing the target object can be intercepted from the image, the initial depth detection network model is trained by using the cut image, and a depth detection network model used for detecting the position of the target object in the image is obtained. For a super-large image, the image can be intercepted into a cut image with a relatively small pixel value in an image cutting manner, so that the initial depth detection network model can realize detection and analysis of the cut image, and the purpose of detection and analysis of the super-large image is achieved.

The invention relates to a method for detecting nine cholesterol oxides in food by gas chromatography-mass spectrometry, which comprises the following steps: S1, adding 19-hydroxycholesterol as an internal standard substance to carry out sample lipid extraction; S2, dissolving the obtained lipid extract, and carrying out saponification extraction to remove moisture so as to obtain a concentrated filtrate; S3, purification and concentration: adding 3mL of n-hexane, shaking and dissolving, adding into activated NH2-SPE, washing the column, discarding waste liquid, collecting filtrate, and blow-drying by nitrogen; S4, derivatization: adding 100 [mu] L of N, O-bis (trimethylsilane) trifluoroacetamide BSTFA for derivatization for 40 min, blow-drying with nitrogen, and dissolving with 1.0 mL of n-hexane to a constant volume; and S5, taking a mixed standard solution of nine cholesterol oxides, detecting the mixed standard solution under gas chromatography conditions and mass spectrometry conditions, and drawing a standard curve. According to the method, a pretreatment mode suitable for complex samples is established, saponification conditions and a solid-phase extraction column are optimized, the accuracy of analysis and detection is improved by adopting an internal standard substance, and the method has the advantages of accuracy, high efficiency and wide applicability.

The invention relates to a monomolecular protein detection chip and a monomolecular protein detection method based on ultramicro electrode array electrochemiluminescence. The monomolecular protein detection chip is provided with a substrate of an ITO (indium tin oxide) electrode and an inclined micro trap array with a three-dimensional concave part on the ITO electrode, the two ends of the inclined micro trap array in the transverse direction are respectively provided with wires connected with the positive electrode and the negative electrode of a power supply. The single-molecule protein detection chip is simple to prepare, an electrochemical luminescence detection system further amplifies a signal, and high-sensitivity single-molecule detection of trace protein can be realized.

The invention discloses a parallel detection and arbitrary combination integrator for multi-index integrated reagents. The parallel detection and arbitrary combination integrator for the multi-index integrated reagents comprises an integration frame, wherein an integration card loading table and an integration kit storage layer are arranged on the integration frame; an integration card is positioned on the integration card loading table; the integration kit storage layer is located above the integration card loading table; an integrated reagent taking head is arranged on the integration frame and connected with an upper membrane breaker and a lower membrane breaker; the integrated reagent taking head moves in the horizontal and vertical directions of the integration frame to reach a target hole of one integration kit, and the upper membrane breaker and the lower membrane breaker on the integrated reagent taking head cooperate to puncture upper and lower sealing membranes of the kit to load a target integrated reagent in the integration kit into a corresponding hole in the integration card. According to the integrator, the integrated reagents corresponding to detection indexes are loaded to the integration card in sequence according to detection requirements of a patient respectively so as to realize smart integration, then grouping parallel processing and reaction are performed, detection and analysis of any project group are realized, and multi-index instant detection efficiency of in-vitro luminescence immunity is improved.

The invention discloses a blood coagulation test system driven by sound waves. The blood coagulation test system driven by sound waves comprises a hollow glass substrate, an interdigital transducer, apiezoelectric plate, a blood movement reaction tank, a detection electrode and an image acquisition and analysis system, and an interdigital electrode is evaporated on the substrate; the piezoelectric plate is placed on the interdigital electrode; an annular blood reaction tank obtained through cutter cutting is in bonding with the piezoelectric plate through surface treatment; the detection electrode is fixed to the reaction tank through a fixing spring; and by adjusting the position of a bracket, it is ensured that the image acquisition system is located at a suitable position, and the movement condition of blood can be recorded in real time. The blood coagulation test system driven by sound waves is simple and convenient in equipment, the integration level is high, required samples areless, energy consumption is lower, the reaction efficiency is high, open type reaction is easy to operate and maintain, and detection and analysis of various parameters in the blood coagulation process can be realized.

The invention provides a terahertz material micro-nano defect detection device and method based on multi-frequency point information fusion. The device comprises a microwave excitation source, a terahertz transceiver module, a mirror surface combination module, a nano probe, an oscillation signal source, a lock-in amplifier and an upper computer, the microwave excitation source is used for generating an input signal input into the terahertz transceiver module and a frequency mixing signal input into the lock-in amplifier; the terahertz transceiver module is used for continuously radiating terahertz waves and receiving an evanescent signal locally enhanced and modulated by the nanoprobe; the mirror surface combination module is used for tightly coupling terahertz wave beams radiated by the terahertz receiving and transmitting module at the tip of the nanoprobe and reflecting an evanescent signal which is locally enhanced and modulated by the nanoprobe back to the terahertz receiving and transmitting module; and the oscillation signal source is used for generating a first signal for controlling the nanoprobe and a second signal input into the lock-in amplifier.

The invention belongs to the technical field of water quality detection, and discloses a heavy metal water quality detector which comprises a pretreatment device, a pre-detection device, a quantitative detection device and a control device, a filter tank and a first stirring piece are arranged in the pretreatment device; the pre-detection device is communicated with the pretreatment device, and a second stirring piece and a turbidity sensor are arranged in the pre-detection device; the quantitative detection device is communicated with the pretreatment device and is used for detecting the content of heavy metal ions in the to-be-detected water sample; the control device comprises a controller, and a control panel, a display screen body and a data storage module which are electrically connected with the controller; the controller is electrically connected with the first stirring piece, the second stirring piece and the turbidity sensor. Whether quantitative detection is needed or not is judged according to the pre-detection result of the to-be-detected water body, then water quality detection is carried out specifically and efficiently, detection is convenient and rapid, and resource waste caused by detection of the water body reaching the standard is avoided while subsequent water sample treatment is guided.

The invention discloses an in-situ integrated multi-spectrum measurement system and method. The system comprises an in-situ integrated multi-spectrum induction excitation unit, at least one light source and excitation light focusing unit, at least three spectrum signal detection units, at least one annular track and radial radiation arms matched with the annular track, wherein each arm slides along the track around the corresponding center axle of the annular track, the total number of the radial radiation arms is at least four. The in-situ integrated multi-spectrum induction excitation unit is a surface plasma resonance coupling element and arranged in the center area of the first annular track. The intersecting line of a non-sample contact surface of a surface plasma resonance sensing film and a central symmetrical surface of a surface plasma resonance coupling prism is coincident with the center axle of the first annular track. The light source, the excitation light focusing unit, and the spectrum signal detection units are respectively fixed on the respective radial radiation arms.

The invention provides a rock slice amplifying and imaging device, system and method. The device comprises a cover body which is used for preventing X-rays from leaking, and a rock slice sample containing device, an X-ray receiving plate and an X-ray generation device which are separately arranged in the cover body, so that the X-rays with scattering angles and emitted by the X-ray generation device penetrate through a target rock slice sample in the rock slice sample containing device. The X-ray generating device, the rock slice sample containing device and the X-ray receiving plate are sequentially arranged along the length direction of the cover body; the X-ray receiving plate is used for moving along the length direction and / or the width direction of the cover body in an area between the rock slice sample containing device and the inner wall of one side of the cover body so as to amplify and image the target rock slice sample through which X-rays penetrate. According to the invention, the amplification and imaging effect of a rock slice can be improved, and the definition of a rock pore structure and internal fluid recognition can be improved.

The invention relates to an organic chemical synthesis reactor capable of being integrally operated. The organic chemical synthesis reactor capable of being integrally operated comprises a reaction bottle, a reaction bottle cover, a reaction bottle heating device, an ultrasonic sprayer, an xenon lamp, a temperature-measuring and cooling device, an extracting device, an eluant preparation device, achromatographic column separating device and a receiving bottle, wherein the reaction bottle cover is arranged on the top of the reaction bottle and is sealed with the reaction bottle; the reaction bottle heating device is arranged on the bottom and / or the side part of the reaction bottle; the ultrasonic sprayer is communicated with the inner part of the reaction bottle; the xenon lamp and the temperature-measuring and cooling device respectively penetrate into the reaction bottle from the reaction bottle cover; the extracting device is arranged on the bottom of the reaction bottle and is communicated with the inner part of the reaction bottle; the extracting device and the eluant preparation device separately communicate with the chromatographic column separating device; and the chromatographic column separating device is communicated with the receiving bottle. The organic chemical synthesis reactor has the advantages of being capable of performing separation of solid products, liquid products and gas-phase products, saving organic synthesis experiment time and reducing waste of reaction raw materials and energy consumption loss.

The invention provides a hierarchical analysis method for a social network emergency. The Hierarchical analysis method for the social network emergency comprises the steps that a burst hot word concurrence graph is obtained; a bipartite graph corresponding to the burst hot word concurrence graph is confirmed, a K fraction filtration processing is conducted on the bipartite graph, and all K fraction associations and each largest fraction corresponding to the correspond K fraction association are obtained; according to a preset measure index, burst hot word nodes included in each largest fraction corresponding to the correspond K fraction association are ranked in descending order; according to the rank sequence of burst hot word nodes in all largest fraction after handled after processing in the descending order, an emergency specification tree is constructed; a width precedence traversal at a K tree depth is conducted on the emergency specification tree , and K depth branches and a sub-branch corresponding to each K depth branch are confirmed; a sub-emergency of the emergency which is formed by the burst hot word nodes included in largest fraction of each branch, that is each K depth branch, and the corresponding sub-branch is confirmed, and therefore the detection for the emergency and the sub- emergency of fine-granularity is realized.

The invention belongs to the field of nucleic acid detection, and discloses a nucleic acid detection card box capable of preventing nucleic acid pollution, which comprises a closed bottom plate, and the bottom plate is provided with a chip socket for inserting and detecting a chip with a detection sample; the chip destroying structure is used for destroying the sealing film on the chip and releasing the detection sample; the liquid storage bubble cap is used for pre-storing a buffer solution; the bubble cap release module is used for damaging the liquid storage bubble cap and releasing the buffer solution; a detection sample and the buffer solution flow into the test strip after being uniformly mixed. According to the nucleic acid detection card box, sealing of the chip sealing film is destroyed through the chip destroying structure, a detection sample is released, a buffer solution is released through the pressure liquid storage bubble cap, the detection sample diluted by the buffer solution automatically flows to a sample loading area of the test strip, and then detection and analysis of a nucleic acid amplification product are achieved on the test strip through chromatography and an immune binding principle.

The invention relates to synthesis of kits, in particular to a D-amino acid detection kit and a detection method thereof. The kit contains D-amino acid enzyme, a 1, 4-benzeneboronic acid solution anda gold nanoparticle solution, wherein the volume ratio is 1: (1-5): (10-20). The kit is simple and easy to operate, can realize green and pollution-free D-amino acid detection, and has potential application value in the research fields of molecular biology, bioanalytical chemistry, marine science, tumor science and the like.

The invention relates to a single-molecule protein detection chip and method based on electrochemiluminescence of an ultra-micro electrode array, and specifically discloses that the single-molecule protein detection chip has a substrate with an ITO electrode and a slanted microstructure with a three-dimensional concave on the ITO electrode. Well array; two ends in the lateral direction of the inclined micro well array are respectively provided with wires connected to the positive and negative electrodes of the power supply. The single-molecule protein detection chip of the invention is simple to prepare, the electrochemiluminescence detection system further amplifies the signal, and can realize the highly sensitive single-molecule detection of trace proteins.

The invention provides a monocrotophos nucleic acid aptamer, an aptamer derivative and application thereof, and relates to the technical field of aptamers. The nucleotide sequence of the monocrotophosnucleic acid aptamer is CCGCTGAAGCTCCGGCTGCAGCGATTCAAGACGATTCGAACGAGTCGCTCTTG. The 5' tail end of the monocrotophos nucleic acid aptamer is marked with a fluorophore, a sequence complementarily hybridized with the monocrotophos nucleic acid aptamer is designed, a quenching group is marked at the 3' tail end of the monocrotophos nucleic acid aptamer, and when the monocrotophos nucleic acid aptameris hybridized with a complementary sequence, a fluorescence signal is very weak; when the moncrotophos recognizes and binds to nucleic acid aptamer, the aptamer structure conversion causes complementary sequence dissociation to enhance the fluorescence signal, the change of the fluorescence signal can be utilized to establish a standard curve, and the monocrotophos aptamer screened by an SELEX technique has the advantages of favorable specificity, high affinity, high stability, convenient use and the like, and can be used for monocrotophos detection and analysis.

The invention discloses a differential nuclease digestion method and application thereof to detecting mRNA internal modification through LC-MS. The differential nuclease enzyme-digestion method comprises, according to the characteristic of difference of S1 nuclease and phosphodiesterase I in digestion of the 5'-end cap structure of mRNA, digesting the mRNA into nucleosides through the S1 nuclease and the phosphodiesterase I, then performing LC-MS detecting analysis, and combining the detecting results of digestion through the two nucleases to differentiate N7-methyguanosine (m7G) in the cap and the inside of the mRNA and according to the achieve qualitative and quantitative analysis on the m7G inside the mRNA. The differential nuclease enzyme-digestion method is high in sensitivity and selectivity, can quantitatively detect the content of m7G inside encaryotic mRNA and further can be applied to study of related functions of the m7G inside the mRNA.

The invention relates to an intelligent blind guiding device and a blind guiding crutch provided with the same. A central processing unit obtains a user location according to a positioning module, obtains destination information through a voice input module, then determines an optimal walking trip route through a path planning module, and plays navigation information through a voice prompt module; and road condition information is analyzed in real time during navigation with the combination of a data storage unit, an image acquisition module and road condition analysis module, and prompt information is played in real time through the voice prompt module to guide a user to travel. The intelligent blind guiding device is integrally arranged on the blind guiding crutch, hats and other articles for daily use, thereby being able to make accurate detection and reasonable evaluation of traffic signals, obstacles, potholes, pedestrians, vehicles and the like, provide timely and reasonable voice prompts for the user, provide convenience for travels of special population fields especially for the blind and the elderly, and achieve precise positioning, path navigation, traffic detection and voice prompt functions, so that the intelligent blind guiding device has a wide popularization significance.

The invention discloses a porous array electromagnetic field reinforced SERS (surface enhanced raman scattering) device for detecting trace microcystic toxins and a preparation method of the porous array electromagnetic field reinforced SERS device. The device comprises a silicon dioxide substrate layer and a film layer which are adhered to each other, wherein a window is reserved in the silicon dioxide substrate layer to enable a part of the film layer to be exposed; a metal layer is adhered to the surface of the window and the exposed film layer; upper and lower through holes A and B which are distributed in an array manner are respectively formed in the exposed film layer and the metal layer on the exposed film layer; and the film layer is a silicon nitride film, a molybdenum disulfide film or a graphene film. The invention further discloses a method for detecting trace microcystic toxin molecules in a water environment by utilizing the SERS device. By adopting the method, detection of through hole weak current signals of the trace microcystic toxin molecules and enhancement of weak Raman scattering signals of the trace microcystic toxin molecules are achieved, and detection of the contents of trace molecules and detection of surface enhanced Raman scattering signals are achieved simultaneously.

The invention relates to an asphalt pavement material recycling device and an asphalt pavement material recycling method. The asphalt pavement material recycling device is characterized by comprising a solvent storage tank, wherein the inlet of the solvent storage tank is connected with a condenser by a pipeline, the outlet of the solvent storage tank is connected with the inlet of a solvent tank by a pipeline, the outlet of the solvent tank is connected with the inlet of a solvent pump by a pipeline, the outlet of the solvent pump is connected with the inlets of two washing chambers and a flushing device arranged in a high-speed centrifugal machine by three parallel-connected pipelines respectively, the outlet pipelines of two washing chambers are connected with the inlet of the high-speed centrifugal machine, the outlet of the high-speed centrifugal machine is connected with the inlet of a solvent evaporating pot by a pipeline, the outlet of the solvent evaporating pot is connected with one inlet of a blending tank by a pipeline, the other outlet of the solvent evaporating pot and pipelines of steam outlets at the tops of the two washing chambers are converged by pipelines so as to be connected with the condenser, and the other inlet of the blending tank is connected with a fresh asphalt storage tank by a pipeline. According to the asphalt pavement material recycling device and the asphalt pavement material recycling method, aggregates and old asphalts in the old asphalt mixture can be screened and recycled, and besides, a secondary flushing device is arranged, so that the mixture can be effectively separated and filtered.

The invention relates to a water quality analyzing method, which includes the following steps: A, adding in a to-be-measured sample; B, setting the corresponding anticipated phase of an object bacterium, and the anticipated phase is in a lag phase; C, fitting the signals collected in the anticipated phase to achieve a fitted line; and D, starting measurement, obtaining the object curved based on the fitted line and a growth curve, and combining the object curved with the set threshold detection time so as to obtain the initial quantity of the object bacterium. The invention also provides a water quality analyzing device, and has the advantages that no special pretreatment is required, the water quality analyzing method and the water quality analyzing device are widely applicable and simple, and the background interference is effectively overcome.

The invention relates to a photo-fuel cell self-powered sensor based on anode light induction and an environmental pollutant analysis method. The sensor comprises a photo-anode, a cathode, photo-anodefuel and cathode fuel; the photo-anode is a Ti-Fe-O NTs / Ni (OH) 2 electrode, the cathode is a GSE / G / MIP electrode, the photo-anode fuel is glucose, and the cathode fuel is K3 [Fe (CN) 6]. Compared with the prior art, a detection mode of energy supply and sensing separation is realized; the output power, the stability and the selectivity of the self-powered sensor are greatly improved, the sensitivity is high, and the detection limit on environmental pollutants ATZ and the like is as low as 2.81 pM. Meanwhile, the preparation method is simple, the cost is low, the analysis method is simple andconvenient, and the method has good reproducibility and an application prospect for on-site determination.

The invention discloses a silicon-based gold nano bowl array chip, and a preparation method and an application thereof. The silicon-based gold nano bowl array chip comprises a gold nano bowl array and a sulfhydryl modified silicon slice; the gold nano bowl array is spread on the sulfhydryl modified silicon slice, and Au-S bond connection is formed between the gold nano bowl array and the sulfhydryl modified silicon slice. The silicon-based gold nano bowl array chip is applied in MALDI-MS detection of biomolecules. The method for MALDI-MS detection of the biomolecules comprises the following steps: dropwise adding a mixed liquid of a biomolecule sample and a matrix on the silicon-based gold nano bowl array chip, drying and crystallizing, attaching the treated silicon-based gold nano bowl array chip onto an MALDI-MS target plate, and then carrying out MALDI-MS detection. The silicon-based gold nano bowl array chip has the advantages of high sensitivity, good reproducibility, simple operation and low cost.

The invention discloses a full-automatic air microbe sampler. The sampler comprises a sample collection system and a sample liquid distribution system; wherein the sample collection system comprises a sampling head, a blower, an impact sampling bottle, a liquid storage bottle, an injection pump and a sampling pump; and two outlets of the sampling head are respectively communicated with the blower and the impact sampling bottle; an air inlet of the sampling pump is communicated with the impact sampling bottle; the liquid storage bottle is consequentially communicated with the injection pump and the impact sampling bottle; the sample liquid distribution system comprises a peristaltic pump and an injection device; the peristaltic pump is communicated with the impact sampling bottle, and an outlet of the peristaltic pump is connected with the injection device through a pipeline. According to the full-automatic air microbe sampler, the sampling head can utilize a two-stage virtual impact theory, so that wall damage of particles is reduced, and high particle diameter cutting efficiency is obtained; simultaneously, sampling flow is large, microbial particle collection density is improved, further experimental analysis is facilitated, and sensitivity and accuracy of devices are improved.