35results about How to "Realize detection and analysis" patented technology

The invention discloses an in-situ integrated multi-spectrum measurement system and method. The system comprises an in-situ integrated multi-spectrum induction excitation unit, at least one light source and excitation light focusing unit, at least three spectrum signal detection units, at least one annular track and radial radiation arms matched with the annular track, wherein each arm slides along the track around the corresponding center axle of the annular track, the total number of the radial radiation arms is at least four. The in-situ integrated multi-spectrum induction excitation unit is a surface plasma resonance coupling element and arranged in the center area of the first annular track. The intersecting line of a non-sample contact surface of a surface plasma resonance sensing film and a central symmetrical surface of a surface plasma resonance coupling prism is coincident with the center axle of the first annular track. The light source, the excitation light focusing unit, and the spectrum signal detection units are respectively fixed on the respective radial radiation arms.

The invention relates to a method for detecting organic pollutants by virtue of combination of solid phase micro-extraction and surface enhancement Raman. The method comprises the following steps: with a solid phase micro-extraction probe as a surface enhancement Raman active substrate, extracting for 3-10 hours in the to-be-detected environment under the stirring condition with the temperature of 20-30 DEG C, then putting the solid phase micro-extraction probe on a Raman detection platform, irradiating the solid phase micro-extraction probe by using laser to obtain Raman characteristic peaks of the to-be-detected organic pollutants, and analyzing the detected organic pollutants according to the Raman characteristic peaks. The method for detecting the organic pollutants is integrated with the advantages of the solid phase micro-extraction technology and the surface enhancement Raman technology; the organic pollutants in the environment can be quickly analyzed and detected; the sameness analysis of polyaromatic hydrocarbon can be realized; polyaromatic hydrocarbon mixtures can be detected and analyzed.

The invention relates to an asphalt pavement material recycling device and an asphalt pavement material recycling method. The asphalt pavement material recycling device is characterized by comprising a solvent storage tank, wherein the inlet of the solvent storage tank is connected with a condenser by a pipeline, the outlet of the solvent storage tank is connected with the inlet of a solvent tank by a pipeline, the outlet of the solvent tank is connected with the inlet of a solvent pump by a pipeline, the outlet of the solvent pump is connected with the inlets of two washing chambers and a flushing device arranged in a high-speed centrifugal machine by three parallel-connected pipelines respectively, the outlet pipelines of two washing chambers are connected with the inlet of the high-speed centrifugal machine, the outlet of the high-speed centrifugal machine is connected with the inlet of a solvent evaporating pot by a pipeline, the outlet of the solvent evaporating pot is connected with one inlet of a blending tank by a pipeline, the other outlet of the solvent evaporating pot and pipelines of steam outlets at the tops of the two washing chambers are converged by pipelines so as to be connected with the condenser, and the other inlet of the blending tank is connected with a fresh asphalt storage tank by a pipeline. According to the asphalt pavement material recycling device and the asphalt pavement material recycling method, aggregates and old asphalts in the old asphalt mixture can be screened and recycled, and besides, a secondary flushing device is arranged, so that the mixture can be effectively separated and filtered.

The invention discloses a porous array electromagnetic field reinforced SERS (surface enhanced raman scattering) device for detecting trace microcystic toxins and a preparation method of the porous array electromagnetic field reinforced SERS device. The device comprises a silicon dioxide substrate layer and a film layer which are adhered to each other, wherein a window is reserved in the silicon dioxide substrate layer to enable a part of the film layer to be exposed; a metal layer is adhered to the surface of the window and the exposed film layer; upper and lower through holes A and B which are distributed in an array manner are respectively formed in the exposed film layer and the metal layer on the exposed film layer; and the film layer is a silicon nitride film, a molybdenum disulfide film or a graphene film. The invention further discloses a method for detecting trace microcystic toxin molecules in a water environment by utilizing the SERS device. By adopting the method, detection of through hole weak current signals of the trace microcystic toxin molecules and enhancement of weak Raman scattering signals of the trace microcystic toxin molecules are achieved, and detection of the contents of trace molecules and detection of surface enhanced Raman scattering signals are achieved simultaneously.

The embodiment of the invention discloses an image processing method and device based on anchor point image cutting, equipment and a medium, and the method comprises the steps: obtaining the anchor point information of an image based on the annotation information of the image; wherein the anchor point information may include center point information and size information of the anchor point identification frame. The size information of the sliding window can be accurately determined according to the set maximum value of the sliding window, the minimum value of the sliding window, the size multiple and the size information of the anchor point identification frame; and on the basis of the sliding window size information and the center point information, a cut image containing the target object can be intercepted from the image, the initial depth detection network model is trained by using the cut image, and a depth detection network model used for detecting the position of the target object in the image is obtained. For a super-large image, the image can be intercepted into a cut image with a relatively small pixel value in an image cutting manner, so that the initial depth detection network model can realize detection and analysis of the cut image, and the purpose of detection and analysis of the super-large image is achieved.

The invention relates to a monomolecular protein detection chip and a monomolecular protein detection method based on ultramicro electrode array electrochemiluminescence. The monomolecular protein detection chip is provided with a substrate of an ITO (indium tin oxide) electrode and an inclined micro trap array with a three-dimensional concave part on the ITO electrode, the two ends of the inclined micro trap array in the transverse direction are respectively provided with wires connected with the positive electrode and the negative electrode of a power supply. The single-molecule protein detection chip is simple to prepare, an electrochemical luminescence detection system further amplifies a signal, and high-sensitivity single-molecule detection of trace protein can be realized.

The invention provides a terahertz material micro-nano defect detection device and method based on multi-frequency point information fusion. The device comprises a microwave excitation source, a terahertz transceiver module, a mirror surface combination module, a nano probe, an oscillation signal source, a lock-in amplifier and an upper computer, the microwave excitation source is used for generating an input signal input into the terahertz transceiver module and a frequency mixing signal input into the lock-in amplifier; the terahertz transceiver module is used for continuously radiating terahertz waves and receiving an evanescent signal locally enhanced and modulated by the nanoprobe; the mirror surface combination module is used for tightly coupling terahertz wave beams radiated by the terahertz receiving and transmitting module at the tip of the nanoprobe and reflecting an evanescent signal which is locally enhanced and modulated by the nanoprobe back to the terahertz receiving and transmitting module; and the oscillation signal source is used for generating a first signal for controlling the nanoprobe and a second signal input into the lock-in amplifier.

The invention belongs to the technical field of water quality detection, and discloses a heavy metal water quality detector which comprises a pretreatment device, a pre-detection device, a quantitative detection device and a control device, a filter tank and a first stirring piece are arranged in the pretreatment device; the pre-detection device is communicated with the pretreatment device, and a second stirring piece and a turbidity sensor are arranged in the pre-detection device; the quantitative detection device is communicated with the pretreatment device and is used for detecting the content of heavy metal ions in the to-be-detected water sample; the control device comprises a controller, and a control panel, a display screen body and a data storage module which are electrically connected with the controller; the controller is electrically connected with the first stirring piece, the second stirring piece and the turbidity sensor. Whether quantitative detection is needed or not is judged according to the pre-detection result of the to-be-detected water body, then water quality detection is carried out specifically and efficiently, detection is convenient and rapid, and resource waste caused by detection of the water body reaching the standard is avoided while subsequent water sample treatment is guided.

The invention provides a rock slice amplifying and imaging device, system and method. The device comprises a cover body which is used for preventing X-rays from leaking, and a rock slice sample containing device, an X-ray receiving plate and an X-ray generation device which are separately arranged in the cover body, so that the X-rays with scattering angles and emitted by the X-ray generation device penetrate through a target rock slice sample in the rock slice sample containing device. The X-ray generating device, the rock slice sample containing device and the X-ray receiving plate are sequentially arranged along the length direction of the cover body; the X-ray receiving plate is used for moving along the length direction and/or the width direction of the cover body in an area between the rock slice sample containing device and the inner wall of one side of the cover body so as to amplify and image the target rock slice sample through which X-rays penetrate. According to the invention, the amplification and imaging effect of a rock slice can be improved, and the definition of a rock pore structure and internal fluid recognition can be improved.

The invention relates to an organic chemical synthesis reactor capable of being integrally operated. The organic chemical synthesis reactor capable of being integrally operated comprises a reaction bottle, a reaction bottle cover, a reaction bottle heating device, an ultrasonic sprayer, an xenon lamp, a temperature-measuring and cooling device, an extracting device, an eluant preparation device, achromatographic column separating device and a receiving bottle, wherein the reaction bottle cover is arranged on the top of the reaction bottle and is sealed with the reaction bottle; the reaction bottle heating device is arranged on the bottom and/or the side part of the reaction bottle; the ultrasonic sprayer is communicated with the inner part of the reaction bottle; the xenon lamp and the temperature-measuring and cooling device respectively penetrate into the reaction bottle from the reaction bottle cover; the extracting device is arranged on the bottom of the reaction bottle and is communicated with the inner part of the reaction bottle; the extracting device and the eluant preparation device separately communicate with the chromatographic column separating device; and the chromatographic column separating device is communicated with the receiving bottle. The organic chemical synthesis reactor has the advantages of being capable of performing separation of solid products, liquid products and gas-phase products, saving organic synthesis experiment time and reducing waste of reaction raw materials and energy consumption loss.

The invention provides a hierarchical analysis method for a social network emergency. The Hierarchical analysis method for the social network emergency comprises the steps that a burst hot word concurrence graph is obtained; a bipartite graph corresponding to the burst hot word concurrence graph is confirmed, a K fraction filtration processing is conducted on the bipartite graph, and all K fraction associations and each largest fraction corresponding to the correspond K fraction association are obtained; according to a preset measure index, burst hot word nodes included in each largest fraction corresponding to the correspond K fraction association are ranked in descending order; according to the rank sequence of burst hot word nodes in all largest fraction after handled after processing in the descending order, an emergency specification tree is constructed; a width precedence traversal at a K tree depth is conducted on the emergency specification tree , and K depth branches and a sub-branch corresponding to each K depth branch are confirmed; a sub-emergency of the emergency which is formed by the burst hot word nodes included in largest fraction of each branch, that is each K depth branch, and the corresponding sub-branch is confirmed, and therefore the detection for the emergency and the sub- emergency of fine-granularity is realized.

The invention relates to synthesis of kits, in particular to a D-amino acid detection kit and a detection method thereof. The kit contains D-amino acid enzyme, a 1, 4-benzeneboronic acid solution anda gold nanoparticle solution, wherein the volume ratio is 1: (1-5): (10-20). The kit is simple and easy to operate, can realize green and pollution-free D-amino acid detection, and has potential application value in the research fields of molecular biology, bioanalytical chemistry, marine science, tumor science and the like.

The invention provides a monocrotophos nucleic acid aptamer, an aptamer derivative and application thereof, and relates to the technical field of aptamers. The nucleotide sequence of the monocrotophosnucleic acid aptamer is CCGCTGAAGCTCCGGCTGCAGCGATTCAAGACGATTCGAACGAGTCGCTCTTG. The 5' tail end of the monocrotophos nucleic acid aptamer is marked with a fluorophore, a sequence complementarily hybridized with the monocrotophos nucleic acid aptamer is designed, a quenching group is marked at the 3' tail end of the monocrotophos nucleic acid aptamer, and when the monocrotophos nucleic acid aptameris hybridized with a complementary sequence, a fluorescence signal is very weak; when the moncrotophos recognizes and binds to nucleic acid aptamer, the aptamer structure conversion causes complementary sequence dissociation to enhance the fluorescence signal, the change of the fluorescence signal can be utilized to establish a standard curve, and the monocrotophos aptamer screened by an SELEX technique has the advantages of favorable specificity, high affinity, high stability, convenient use and the like, and can be used for monocrotophos detection and analysis.